100th post. with pics

Since joining my new work here in Amsterdam I've been trough some amazing stuff. This is my life in the last week. In pictures because I'm tired and slightly drunk.

Some of the guys at work. In this case the sweeds.



What to do here before you die, money allows... that is






The smallest pub in town. not so bad.. Going to the bathroom, now there's a challenge for any wannabe climber!


I know a'dam is a fucking playground.. but this is ridiculous. A ferris wheel and other amusements in the center of the square!

Damn!!

So I finally get around to going to Teasers, at a couple of colleagues invite, and when I get here, all I get is beer! It seems the Dutch government banned the bodyshots and topless serving there. Too bad. The girls ain't what hulf promised (am I getting you in trouble know luv ?) , but at least I got this one to smile and dance for me. And pose for a lousy photo.



Coco is a dancer, (this sounds like a song title...) and a waitress. She's also very nice and cheerful. So it was worth the 6 euros. (the beer god damn it, what else would I've meant?)

On a side note, today I found two dutch kids (in their late teens) who speak portuguese. I wish I went to school in a country where you can learn just about any language you want.

Für mein schatz

lös mich auf wie zucker
wenn du die zeit dafür findest
machs sanft und plötzlich
im handstreich
oder einfach nur mit einem blick
es war alles schon mal da
machs am besten noch während ich tanze
ich tanze
ich tanze
du atmest wie ein funke, ohne körper mitten in mir
sehnsucht ist die einzige energie

Eintürzende Neubauten - Von Wegen (Alles Wieder Offen)

PersonalDNA Score

Lay sunday, oh lazy sunday..

Well, to cheer me up on a lazy sunday nothing better than a personality test. This one I got compliment's of Restelo, a portuguese blogger who also relocated recently and whose blog I'm a devoted follower (Oh, her blog is in Portuguese, so....)

So, as I was saying, this test, PersonalDNA was actually one of the funniest I tried so far, and attributing me a result like "Generous Leader" how can it be wrong? Yes, "Glorious Leader" would be a stretch...

Unfortunatly, it only gives you a little badge as a reward, but I took a snapshot of the full personality trait chart, so here it is:

The return of the Undead Terrorist (and his wife) and how my first week ended in red

Para acabar a semana, e porque já tenho a mobilia montada e portanto estou a sofrer de uma depressão pós-saida-da-linha-de-montagem cá vai o ultimo post sobre a minha mudança para Amsterdão.

Então, ontem á noite aparece-me a porta o clã Hussein para se darem a conhecer e prontinhos para me ajudar. Lá houve mais um susto, sim porque eu não estou habituado a receber visitas de apelidos tão ilustres! Mas desta vez passou logo que o pequeno Undead Terrorist saltou para cima da mesa (que eu ainda mal tinha apertado os ultimos parafusos...) e começou a dar luz á minha nova sala. (Se um dia eu lhe conseguir tirar uma foto ás escondidas, percebem o porque da alcunha. Porque não tirar uma foto á descarada? Porque ai eu ia deixar de ter duvidas sobre se o UT é capaz de matar ou não!)

Pormenor interessante e vá.. intrigante. Como é que um tuga que fala em inglês o dia todo se entende com um bulgaro-turco a viver na Holanda? Em alemão, claro! E muita linguagem gestual.

Fast-forward para hoje á tarde. A mobilia está montada, a casa e a loiça limpas, luz em todas as divisões. Decido oferecer-me uma prenda e vou comer batatas fritas com maionese para a Dam Square. Dou umas voltas, evito as ruas que já conheço e meto-me no Red Light sem me aperceber. Primeiro sinal, os ingleses histéricos, seguidos dos passadores e por fim as luzes. As cortinas estavam quase todas fechadas, o que quer dizer que havia muita gente mais divertida do que eu. Em numero igual estavam outras a trabalhar no duro. Volto para casa porque nunca gostei particularmente de olhar para as montras de um talho.

Para fechar, umas fotos da minha primeira semana aqui. A qualidade é terrivel, e fica aqui a nota. Aceitam-se donativos para a compra de telémovel de ultima geração.

















Ah, estas duas ultimas fotos têm dedicatoria. A da direita vai com um abraço para o cromo lampião que me fazia companhia na Caixa e a da esquerda, com um grande beijinho de Gute Besserung, para uma leitora especial deste berloque. Já sabes que se quiseres andar... Isto aqui é sempre a direito! :o)

Going with the flow

Lately my collages at prt.sc have been printing their terminal usage history. I found mine to be interesting, so I'll post it too.

BlackBookII:~ jpa$ history | awk '{print $2}' | sort | uniq -c | sort -rn | head
59 ruby
59 clear
51 dscacheutil
37 ls
35 java
35 cd
31 sudo
24 vi
20 ps
19 rm

Yeah, I like to clear the output before doing something else... The dscacheutil honorable mention is a memory from my home in Portugal, see, the problems I had with Meo vs Leopard never quite disappeared and doing a "dscacheutil -flushcache" was the only way to get over the nagging network resolution bug.

Super-Master-Ikea-Ninja

É assim que me sinto hoje.

Ontem fui ao Ikea cá do sitio,fazer a minha certificação super master customer, que é como quem diz, mobilar a segunda casa em menos de 6 meses. Nada de especial, só é preciso apanhar um metro (aqui a definição de metro é diferente. É um comboio da zona metropolitana, tem estações subterrâneas mas a maioria é de superficie) de Lalylaan para Bullewijk e mais 6 minutos a pé. Para memoria futura, Lalylan para mim é ladyland e Bullewijk é bolchevique. Fica dito.

Bem chegado lá, sou confrontado com uma certa alegria por o catalogo ser quase igual ao de Portugal, o que quer dizer que não tenho dificuldade em encontrar o que procuro. Isto porque as imagens enganam, certo? errr ok. De resto há uma certa familiaridade que já estabeleci com a marca. Aqui por exemplo, em vez de ir ao Continente, vou ao Albert Heijn, em vez de ir ao BES vou ao ABN mas compras é mesmo no Ikea. Dizem que é uma questão geracional.

600 euros depois já tenho um sofá cama, uma mesa e cadeiras, um armário, coisas de cozinha e para a casa, o minimo dos minimos para um touro, diria eu. Que isto do amor e uma cabana pode ser verdade, mas não tenho ca o amor, e a cabana precisa de uns arranjos.

Bom, a entrega do material foi feita, 22h00 em ponto, As duas figuras suspeitas, ao melhor nível de um HP Lovecraft clássico. Passado o susto, e porque queria a mobilia mesmo muito, lá abri a porta. Pessoal simpatico estes turcos. Para terem uma ideia, fiquei com a entrega feita e ainda consegui que um deles, o Hussein (daqui para a frente, the Undead Terrorist) ficasse de me ajudar a montar as coisas, arranjar a iluminação e a mulher dele passou a ser a minha mulher a dias. Nada mau, hein??

Aqui temos a foto uma turca num concerto do Ozzie Osbourne. Acho eu...

The kindness of strangers

Ora, seguindo com os posts sobre a minha realocação cá vão as historias do dia de ontem.

Ia a caminho do gabinete de imigração, no tram 2, e decido perguntar á moça ao meu lado onde devo sair (fica aqui a nota: a saida mais perto do GBA é na Heineken Brewery, mas sem parar para ver a exposição, ok?) . Ela responde-me num pidgin english que me pareceu jamaicano, mas nunca fiando "cume wid me man, I go there too". Conclusão do dia: Ao abordar um estranho em Amsterdão, as hipoteses de:
- este falar inglês :99%
- este ser estrangeiro : 60%
- este ser uma esta : 75%

E pronto, lá fui eu tratar de mais burocracia. Despachado que estava ao fim de 5 minutos, até porque tinha de marcar uma reunião por telefone antes de ir á migra cá do burgo e não o tinha feito, so... no deal. OK, sem problemas, ainda deu para ir ao ABN-AMRO abrir uma conta. News flash: os bancos aqui fazem de tudo para agarrar clientes. Parecem as financeiras de esquina ai em PT. Resultado, abro uma conta sem pagar um centimo. O que vem mesmo a calhar, porque é mais ou menos todo o dinheiro que tenho.

A caminho do banco, e sem grande aviso o ceu deixa de ser tão azul, o sol esconde-se por trás de umas nuvens negras e começa a chover. Granizo. Eu fui apanhado de surpresa, mas não tanto como um ciclista passou por mim a segurar um bebé ao colo. Gente estranha... até me deu arrepios. Já vos falei da minha teoria entre o uso de bicicleta e o consumo de drogas?

Bom, refugio-me dentro de uma tabacaria com um outro transeunde. Um velho daqueles que ainda se deve lembrar da II Guerra Mundial. Queixo-me da chuva e ele não esta com meias medidas... pede-me para esperar um pouco que ele vai a casa buscar um chapeu de chuva para mim! E foi mesmo, á chuva... ao frio... fiquei sem palavras para lhe agradecer e sem 2 euros que tinha no bolso e que insisti em dar-lhe pelo chapeu.


Claro que nem tudo podia ter corrido bem... o chapeu é azul e branco, cores que não me alegram o coração de maneira nenhuma. Nem no estrangeiro!

É oficial. Sou um emigrante

Não trouxe a mala de cartão, mas já tenho algumas historias para contar.

1- Os taxistas são todos iguais. No mundo inteiro! Ontem á noite estava demasiado cansado para me chatear. Mas fica o aviso: There be pirates!
2- O hotel (e toda a zona circundante) onde fiquei, parece ter sido transplantado do norte de Marrocos, o Ibrahim, o Ali e o Mohamed foram os primeiros holandeses com quem falei hoje. Fixe.
3- Tratar do Sofi number é facil. Demorou 15 minutos incluindo espera, fotocopias e converseta da treta com a simpatica menina da repartição.

Bem, tenho de ir ao escritorio. Deixo-vos uma imagem da rua que tenho de passar para lá chegar

1000.times better

Short code post. Just the story of how do you get someone looking into Ruby when they had already dismissed it as a fad. You know, the hype can blind you.

So the situation arrived when a friend needed to have a particular chunk of XML repeated 1000 times. No more, no less. Sounds stupid but it's just an oversimplified anecdote.

When he asked me for a quick script to do it for him, I saw an opportunity to show how Ruby would be a good tool for this job (insert promo here). Being a "show, don't tell" kind of guy, this was the code I presented him.

def thousand_repeater(string, repeats =1000)
repeats.times do
print "#{string}\n"
end
end

Not too fancy by any means. You just have to call it with the string you want, optionally provide the number of times you want it repeated and that's pretty much it.

Ex.: thousand_repeater "hello",3

The thing that got to him was actually the ability that Ruby gives you of doing something like "1000.times", compared to the more familiar (at least for him)

for(i=1; i<1000; i++)

Thats it.

it's official now, so I might just as well shout it out loud!

Que roubo....

Então um gajo em Munique paga 3,60 Eur por 17 cigarros??? Onde é que estão os meus outros 3? Perderam-se???



Esta foi uma semana louca em que conheci mais aeroportos do que em todo o resto da minha vida! Zurique, Amsterdão... Munique. Parece um tour pela Europa civilizada, eu sei. Mas tudo faz sentido. Amanhã conto.

Quando queremos voar mais alto nada melhor que dar um pulo de um sitio muito alto. Ou então correr por uma planicie a perder de vista, qual pista de aeroporto...

;o)

Jantar de Homenagem ao Professor Roberto Barbosa (IADE)

A Kay está a organizar um jantar na "Dona Elisa" em Santos em jeito de homenagem ao Prof. Roberto. Não são bem vindos choramingas nem urbano-depressivos. Os jantares do Rob sempre foram uma festa. Let's keep it that way.

foto da autoria de Roberto Barbosa

Confirmações para estacaoabstracta@yahoo.com.

Obrigado.

Top 5 Videoclips

Gonçalo Viana got this meme type of thing going on were you are supposed to list your 5 favourite video clips, and since it was an open invitation I decided to take him on. Kinda. I made a point of choosing only one clip by artist (or else this would have been a NIN only party) ,also I had to love the song itself and finally they should be listed in no special order.

And the winners are:

Tool - AEnema


Einstürzende Neubauten - Sabrina


Nine Inch Nails - Closer


Recoil - Strange Hours


Queens of The Stone Age - Go With The Flow

O Meo é maior que o teu (1).

A boa noticia é que, após quatro meses, já tenho TV e Net e Telefone. Mais propriamente adquiri o serviço Meo, o triple play da moda. Obrigado á CML e a PT por terem unido esforços e tirado o prédio onde moro da idade das trevas.

A oferta prometia, até porque as medições indicam que disponho dos 16 Mb de ligação, que seria o valor recomendado, mas na verdade apresenta algumas falhas. Nem todas elas relacionadas com o débito de rede. Não nos devemos esquecer que se trata de um produto algo novo no mercado e talvez daqui a uns tempos a qualidade melhore. Só podemos esperar.

Decidi fazer a minha própria critica ao produto uma vez que parece quase impossivel encontrar informação isenta e com algum espirito critico sobre o Meo, a menos que contem com um post ocasional de um empregado do Sapo, ou aquele flog do "omeumeo" que parece ter sido inventado pelo mesmo tipo do segredo vodafone, porque me parece algo..hummm fake. As minhas desculpas se de facto houver um blogger anónimo que avisa a "malta" para problemas com a facturação.

Para dourar a pilula incluo também alguns comentários sobre a qualidade do "networking stack" do Leopard porque dizem que um mal nunca vem só ;o)

- A oferta de canais disponiveis no serviço 30+10 (penso que é o base) é virtualmente igual aos de todos os outros operadores no mercado. Incluido no pacote vem, no entanto, um canal em HD sem qualquer programação de interesse mas que ainda assim vale a pena ver pela qualidade da imagem. Isto, claro, se tiverem uma TV com capacidade para tal.

- A qualidade do router é simpatica. Aparentemente o Leopard é que não gosta muito do wireless porque quando abro o Mail e o Safari em simultâneo, regra geral, perco a ligação. E a imagem da TV. Aborrecidito no minimo.

Pior mesmo é que qualquer site que eu tenha tentado visitar aquando do erro deixa de ficar acessivél, pois mesmo após reabrir o Safari, ou abrir um browser diferente, ou mesmo re-iniciar a maquina (old habits) continuo a receber uma página de "Resolution Successful"...Nota mental: Redefinir o conceito de "Success".

Para resolver a situação é preciso fazer uma limpeza ao cache do felino mais tosco da familia. Já agora, e antes que perguntem.... dscacheutil -flushcache

- Por defeito, ou seja, quando o técnico instalador sai da casa do cliente, a rede wireless faz broadcast do SSID apesar de contar apenas com WEP como medida de segurança. Para alterar estes "pormenores" basta abrir um browser, depois de autenticado na rede, e ir a http:\\home .Ou então http://ip-do-router/xslt?PAGE=J46&THISPAGE=J01&NEXTPAGE=J46 se gostarem de ver mais opções no menu. :o)


- A box com o disco rigido é barulhenta até quando está em stand-by o que me parece estranho, mas segundo o suporte técnico é assim mesmo. A segunda box já não é tão barulhenta, mas também não tem um disco lá dentro, não é?

- A funcionalidade de agendar a gravação de conteudos é desaproveitada porque, como se sabe, raramente a programação dos canais é mantida, pelo que o mais normal será perderem uns minutos do programa. De resto é algo inovador. Se bem que parece que me lembro de em tempos ter havido uns leitores de vhs que também faziam isso.

- A possibilidade de ver os incorrigiveis directa e gratuitamente na TV. Adorei! Parabéns! Se a resolução pudesse ser um pouco melhor ficava perfeito.

- O Video On Demand, apesar de me parecer uma boa ideia ainda não experimentei. Mas gostei de ver a possibilidade de alugar conteudos para adulto. Poderá evitar alguns constrangimentos aos mais timidos... ou "torrent impaired".

Adicionalmente, o Meo oferece um filme por mês para atrair os clientes a este serviço tipo videoclube. Mas, para já, a oferta pareceu-me fraca. Será uma questão de mentalidade, mas não vou experimentar um serviço (mesmo gratuito) se a oferta não me apela minimamente. Quem pensou esta estratégia de marketing espera, certamente, apelar á palavra mais querida do português médio (Grátis) não receando uma certa conotação com a má qualidade do conteudo disponibilizado.

Quanto a limitações técnicas incompreensiveis, até agora, só encontrei duas:
- Desbloquear conteudos para adultos de forma definitiva. Não dá.
Se estiverem a ver o Family Guy e a Megan (Ils son fous ces americains) decidir ter sexo na orelha para preservar a virgindade até ao casamento vão ter de imaginar a cena... a menos que tenham o comando á mão e se lembrem do código de desbloqueio. E mesmo que procedam ao desbloqueio, mas mudem de canal, terão de passar pelo mesmo noutra ocasião em que desejem ver conteudos igualmente chocantes.



Ah... se meter sangue e tripas por todo o lado não há problema. Sexo é que não. Mas isso são contas de outro rosario...

- Durante a gravação de um programa, a segunda box tem de estar sintonizada no canal que está a ser gravado. Esquisito. A box principal deveria poder tratar disso sozinha, não? Será o Windows CE a fazer essa gestão?
Mas giro mesmo é ver a mensagem de aviso que o software apresenta. Lamentavélmente não tenho um screen shot á mão, mas assim que tiver faço o update a este post. Se lerem o aviso ficam mais confusos do que se não o lerem e carregarem na opção que permite continuar a ver o canal...

Tirando isso, e como diriam os Garotos Podres, tudo bem.

1-Ok, este deve ser o pior titulo de um post de todos os tempos. Mas hei, fica como uma homenagem á MyBrand (aqueles do Allgarve e do logo da EDP que diziam ter sido roubado de algum lado) que fizeram aqui um optimo trabalho.

Forget OLPC. OSPC is more like it!

Need help explaining your children why there is a server in the house?



This will help.

What else?

Thanks mom!!

Krav Maga

At the last Prt.sc dinner I was talking about how cool Krav Maga was and how I thought everyone should learn it when I realized that only Andreia knew what the hell I was talking about.


Well, Krav Maga is a personal defense system which originated from Israeli self defense technics and was developed by Imi Lichtenfeld during World War II. The name in hebrew means Combat (Krav) Contact (Maga) which pretty much sums up what's it's objective is... Close, or contact, combat.

Despite it's origin, or maybe because of it, this method now serves as combat training for major armed forces (the SEALS are a notable example) as well as police forces around the world.

If you're in Portugal, you can go to the Portuguese Krav Maga Federation site, or follow this blog to know more about this self defense technique and were you can learn it (by the way, I highly recommend you trying to catch a Paulo Pereira's class). If you're not, and most *my* visitors tend not to be, well try googling for your local Federation or start here.

Here is a little demo Richard Douieb gave at Bercy's International Martial Arts Festival in 2003. Enjoy.


P.S : kudos go out to eduardo, who at 8, is the best student I ever had.

Yet another Mail.app bug

I don't like to repeat myself too much, but it seems that Leopards Mail.app fails at math.




Unless of course 4294967294 is the new zero.

Wanna buy Microsoft for 1 Million Dollars?

Yes you can! And you know you want to!

But be sure to read this first.

News of the world

What an exciting week this has been!

We started of with a native Mono release for OS X, which you can read more about at Miguel's blog.

Then it was Netbeans 6, which is IMHO the best IDE for Ruby and Rails development and it's yours for free. Here.

And today we can rejoice at the launch of Rails 2.0.

Hurray for us!

On a side-note, I just wanted to share with you a conversation I had with a mono hacker regarding the look of Mono on Mac OS X, even if in a somewhat twisted way for better reading :

Me > People are complaining it doesn't look "native".
She > Well, there are two answers for that:
Novell is currently concentrating on making Mono on the Mac a stable development platform. The System.Windows.Forms layer has support for theming and we could accept contributions for a Quartz theme that uses the HIToolbox APIs. Or, in a shorter version, we accept patches.

And then she said goodbye with the funniest tagline I've heard this week :"nothing like a linux forum to complain about how a windows technology looks on a mac"

Leopard Tech Talks

Last monday we've had the first Leopard Tech Talk in Lisbon, but much to my regret I didn't made it.

That's not at all unexpected since I'm having so many "shitty work days (tm)" but what's surprising me the most is that even with such a loyal and committed Mac fan base here, I haven't read a single post or e-mail about it.

Did anyone go? What was it like?

f*ck it!

NIN's remix site is up.

Downloading 15+ years of remixes a registration away!

5 Favorite Movies? Hum... You bet!

I've been seeing a couple of bloggers posting about their favourite movies of all time, and I felt like doing my own "best of" list. The principle is easy: name your 5 favorite films of all time, say something about them and if possible link to their official site or something.
I've also added a couple more rules: Wait until every other blogger in the world have done their own list; Try not to judge their intellect on how bad their choices generally where.

So, having said this, here it goes but in no special order:

* Animatrix
The whole series. All 9 episodes. Loved them and I honestly think it was the best thing coming out from the matrix.


* Fight Club
Pure genious. The book is great, but Edward Norton and Brad Pitt together are better. Let anarchy rule!


* Ghost In The Shell
This one actually changed my life. Very seminal. And the artwork is so inspiring.


*American History X
Again Edward Norton with a great role as a repenting skinhead. Both entertaining and touching. The scene that shows Edward's character grinning as he gets arrested after murdering a man is so scary it definitely makes up for the predictable finale.


* Natural Born Killers
This is how a legend is born. Although Tarantino didn't direct this film, it was is big success as he was the writer. Best Soundtrack ever, courtesy of Mr. Reznor.


* Trainspotting
Here I must concede that the movie lacks in comparison to the book. Still a great movie with a message that changed my mind about what I wanted out of life.
"Choose life. Choose a job. Choose a career. Choose a family. Choose a fucking big television". Check, check, check and... check.


* Deconstructing Harry
Definitely one of Master Allen's masterworks. If you don't laugh trough it, you may be brain-dead and not realize it.


*Brother
Takeshi Kitano, or Beat Kitano as he referes to himself writes, plays and is the meanest yakuza in the world. Ever.

A movie with substance

Every so often I get to see a film that touches me.

It happened recently with shortbus which made me laugh hysterically and this weekend again with Control, a film by the photographer Anton Corbijn.

Corbijn's previous experience with a camera was best known as a music video clip director, with some great bands like Depeche Mode and Red Hot Chili Peppers (Give it away know!) unless that is, you happened to catch his short film "Some YoYo Stuff", about one of Reznor's favorite artists, Captain Beefheart.

I could go on and on about how much Joy Division meant for me or how I and Glen Matlock both got expelled from would-be great bands for dancing to a different beat, but that ain't too much to the point.

The film in it self is heart touching as it tries to properly tell the story of Ian Curtis' Division rise and early demise, and as it would be expected from Corbijn's previous body of work, how the photography is amazing. That isn't my point either.

My point is this: If you have a heart go see this movie and feel it being touched from a distance by a genius.

out on safari and back again

And some people still ask me why I like Firefox better... You know, 75% of my visitors use Firefox. So should the rest of you.

prémios codebits (edit III)

Prémio mais votado pelo publico
sapo frogger - Pedro Cardoso
(com as minhas desculpas pelo erro.)

Prémio Ideias
bookworms - Pedro Sousa

Prémio Remix
sapo boavida - Luis Rei e Samuel Martins

Prémio Geek
Bruno Pedro


ei esta malta é (quase) toda do Prt.Sc !!!!!

Parabéns a todos!

...e o resto já não ouvi. Já só tinha ouvidos para os Wraygunn !

Half backed apple

Ok, so the portuguese version of Apple Store is up, some might say not a minute too soon, but not me.

I mean, either Apple entered the Web 2.0 bandwagon of "release soon, release often" or someone should get their ass kicked. What the hell is up with this 3 language web page?

Do you speek Spanporglish? I didn't bother looking any further. That was quite enough for me.

An ice cream that creamed a car

This is a somewhat old story that I've read some time ago. It came up today in a conversation I was having with some co-screenies.

I had to do some googling, but was able to find a good enough recount of the story. Read it here.

toad codebits day 1 - random thoughts

Well, in and out of the first day of Sapo Codebits, or Toad, and a few thoughts sprung to mind.

I'm gonna do this the old school way of dividing in a The Good, The Bad, The Ugly sort of way, so..

The Good :
- Getting to know fellas like Diogo, Luis, the segway dude, Samuel and the lovely Mono Hacker, and meeting up with "the" PHP Man , the Python Evangelist Extraordinaire, Franc and the hacker behind some of the funniest storys I've heard and of course, the geekiest guy I know Cafonso
- Mike Culver's Presentation. That was what I was there for.

The Bad :
- The Wireless bandwidth available.
- The food.
- Did I mention the low bandwidth (well, the codebits page is kind of remeniscent of a heyday of 16k modems, but come on!!)

The Ugly :
- PT's Pulso app.
I mean, the app/system in itself looks great and seems to be a wonderful piece of enterprisey software, but PT taking advantage of Open Source Software to build a great product and then selling it? What are they giving back to the community? Bug-fixes? Is that enough for such a big company? Shouldn't we expect a little more? Ok, this is just one more reason why I don't like PT, Sapo or any of the PTM companies.

Final verdict:
- If you were there, probably you had fun. If you weren't ,don't feel too bad. It's a well over hyped event.

I'll be back tomorrow, and hopefully I'll be able to catch up again with some of the folks I've met today and be able to see some more presentations.

toad codebits day 1

Well, it seems that I made the cut after all, but I only managed to get here some 30 minutes ago.

Not all is lost, I still managed to catch Mike Culver talk about Amazon WebServices, namely S3 and the amazing EC2. As soon as I'm able I'll post an update about the talk itself and my first impressions.

Stay tuned.

Toad CodeBits

We're just 10 days away from Toad CodeBits.



This promises to be the biggest gathering of 'tuga* code monkeys this year and I'm looking forward to being there. Although, come to think of it, I don't know if I'll actually make it. The thing is, it seems that you have to both register for the event and then make some sort of announcement and hope that you make the final cut.

That last bit seems to be a problem for me, 'cause I really don't like Sapo (the company, the search engine, the portal, the....) at all. But since I have to admit that I would really like to be there, here it goes....

If I manage to get in, I'm looking forward to hearing Mike Culver from Amazon, Marco Gonçalves (on the BSDs) and hu... wraygunn


* 'tuga is slang for Portuguese.

Abertura Facil

Afinal não sou o unico a ter um problema com embalagens de "abertura facil".

Freedom (I still think this is the end of the record industry)

08 october 2007: big news
hello everyone. i've waited a long time to be able to make the
following announcement: as of right now nine inch nails is a totally
free agent, free of any recording contract with any label. i have
been under recording contracts for 18 years and have watched the
business radically mutate from one thing to something inherently very
different and it gives me great pleasure to be able to finally have a
direct relationship with the audience as i see fit and appropriate.
look for some announcements in the near future regarding 2008.
exciting times, indeed.
posted by trent reznor at 10:45 am.

More information on the usual place

FASTA, betta, more

My girlfriend's sister asked for help. But all she got was a 16.

The purpose of this script is to get a file(name) as a first argument, a regexp as a second argument and then search trough the file and print out the whole sequence where any of the possible regexp values are found, being that the searched sequence itself must be identified with "<>" symbols and then do a little basic math with the elements we've found.

To try this out, save the following as (for instance) sequences.txt:

>50c's and 50t's
cccccccccccccccccccccccccccccccccccccccccccccccccctttttttttt
tttttttttttttttttttttttttttttttttttttttt
>10G's and 90A's
GGGGGGGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>A random sequence
ccagtcctgtctaaggactttggttcatgcgttaatttcggttagccagtggcgcccacg
taacaaagtgcgaccgacctgcttccatagcattgaaatgtccttgattggagattttac
gcaggaggactgataagttcgggtctgaattgatgcagcgaacgttcatccaatactcag
acttgcactcagtcg
>A second random sequence
cgcatgacggccctcctcgacggttcattaaccttgcacaccaactgttcctcaaccgat
ctggtgtctttctcacttacatagcagttgctgtaccatttgatgggaacccgagatcac
cgggttatcgcgggagtttattccgaattgttctcggaaatgtggcgtcggcttgaattg
ggaataatacggatcttgacaagcacgatttcatccacaatgcggcacgagtaatcccct
tctggaaggatgcagaaaggacatatacaatgagctagccacgtggcgcataacgcagct
tggttagaaactaaatctatacaggaagatacagaatgggaacagtgtcgctcagtctag
ccagctagatccgcctttagtcgaccttaggggtaaggca

And the below code as scripty.pl:

print "\n\n *girfriends_sister_school_id* \*girfriends_sisters_friend_school_id*\n\n";
print "filename:\n";
$filename = ;
open(TEMPFILE, $filename) or die("Cannot open the file $filename");
print "Insert the regular expression to find:\n";
chomp($regexp=);
while () {

if ( /^>/xms) {
$paragraph = "";
$paragraph_head = $_
}
if ( /^$/xms) {
push @paragraphs, $paragraph;
} else {
$paragraph .= $_;
}
}
push @paragraphs, $paragraph;
foreach (@paragraphs) {
while ( $_ =~ /($regexp)/gi) {
$expressions{$1} += 1;
}
}
foreach $key (keys %expressions) {
print "\n\nPattern = $key\n";
foreach (@paragraphs) {
if ($_ =~ /$key/) {
$paragraph_with_patterns = $_;
$total = length$paragraph_with_patterns;
$counterA = 0;
$counterC = 0;
$counterT = 0;
$counterG = 0;
if ($key =~ /a/){
while ( $paragraph_with_patterns =~ /a/gi) {
$counterA += 1;
$sum1 = ($counterA/$total);
}
}
if ($key =~ /c/){
while ( $paragraph_with_patterns =~ /c/gi) {
$counterC += 1;
$sum2 = ($counterC/$total);
}
}
if ($key =~ /t/){
while ( $paragraph_with_patterns =~ /t/gi) {
$counterT += 1;
$sum3 = ($counterT/$total);
}
}
if ($key =~ /g/){
while ( $paragraph_with_patterns =~ /g/gi) {
$counterG += 1;
$sum4 = ($counterG/$total);
}
}
$paragraph_with_patterns =~ s/($key)/\<$1\>/gi;
print "$paragraph_with_patterns\n\n";
%sum = ();
%sum1 = ();
%sum2 = ();
%sum3 = ();
%sum4 = ();
if ($counterA >0){
%sum1 = ("A", $counterA);
}
if ($counterC >0){
%sum2 = ("C", $counterC);
}
if ($counterT >0){
%sum3 = ("T", $counterT);
}
if ($counterG >0){
%sum4 = ("G", $counterG);
}
%sum = (%sum1,%sum2,%sum3,%sum4);
foreach $key_id (sort hashValueDescendingNum (keys(%sum))) {
$div = ($sum{$key_id}/$total);
print "$key_id = $sum{$key_id} \/ $total = $div\n";
}
}
}
}
sub hashValueDescendingNum{
$sum{$b} <=> $sum{$a};
}
exit;

Then run perl scripty.pl . Put sequences.txt as the file and a[c|t]g as the regexp when prompted.

I had alot of fun doing this wich is a good thing since I didn't get paid.

And no, neither bio::perl, nor any other module for that matter, were options.

Finally, a major thank you must go out to sab for the priceless (as in: he didn't get paid either) help.

::1

This is my new home. I won it in a City contest.





As another geek has said before, the only hard thing to do when moving to a new 127.0.0.1 (or ::1 in IPv6) is dealing with the gas company. What a bunch of pricks!

Well, anyways you're always ...

that's cool

Quicky:

Are you using OS X to develop the next big Rails app and need ImageMagick, RMagick and friends?

Well, just point your browser to rubyforge and download the rmagick-osx-installer package, unzip it and read the fine manual. If you have all the pre-requisites, "sudo run" the installer script and then... go out for a coffee.

When you're back you'll have the following log in your terminal windows:

libpng was installed successfully
libjpeg was installed successfully
ghostscript was installed successfully
ghostscript-fonts-std was installed successfully
FreeType was installed successfully
libwmf was installed successfully
ImageMagick was installed successfully
RMagick was installed successfully
Removing rm_install_tmp directory...Done

That simple.

Rediscovering the desktop

As you might have noticed, I've been on a rather long break from my blogging activity, and again this was due to my Mac being broken. Again.

It's not like I didn't have a replacement (my old trusty Asus M6N), but as I've said before, i get depressed when my Mac brakes. And it just happens oh so many times.

Anyway, the downside, apart from the depression bit, was that I missed the opportunity of ego-blogging about the brand new Ruby-Lang Portuguese site .I'm very proud of being a part of the amazing team behind it, and sincere kudos must go out to Emanuel and Franc.

On the upside I had the chance of rediscovering Linux on the laptop!
I'm lucky that my Asus is a pretty linux-compatible, but with the new Ubuntu 7.04, everything just works. That includes wireless, the extra (media) buttons, the compiz powered desktop effects, the works.

Now, I've been known to prefer Suse/Novel over any Debian based system for users and user-grade hardware, but Ubuntu has been making such an extraordinary evolution that it has (for all that I care) become the de facto distro for desktop use. It just gives you roughly 70% you'll need from the first boot, and the rest you'll get with Automatix. For a little more specific usage needs, the excellent Aptitude app will do the trick. You'll never get so much for so little!

Anyway, here's a little list of apps I've been (re)discovering:
Aptana + RadRails (Netbeans, eat your heart out!. Thankfully its cross-platform);
F-Spot (will give iPhone a run for its money any day);
Songbird (think iTunes minus clutter);
Gnome-Launch-Box (it's a Quicksilver clone, gets the job done);

And a list of what I miss:
Integrated Dictionary just a shortcut away;
Textmate (it was growing on me...);
Dashboard (what? I love eye candy...);

That's not so bad is it?

Making the enterprise see red - part I

Ruby trough Rails has been a poster-child for the so called web 2.0, but in the enterprise level the adoption rate hasn't been all that remarkable.

Rather than go trough an extensive diatribe about how adoption rates in the enterprise for just about any open source technology is always necessarily slow, because no self respecting OSS programmer plays golf, I'll just list some of the perceived weaknesses and shortcoming usually attributed to Ruby.
- Contrary to Perl, it doesn't come installed by default on just about every Unix-like OS;
- The treathing model used is week;
- Rails doesn't scale;
- It's just a fad, and it will go away before it matures;
- Poor Unicode support;
- No single good IDE and Text Editors are soo 80's;
- Nobody wants to learn yet another language especially when there is close to 0 employability for it;

While most of these are (at least to some extent) true, there are many projects that aim at overcoming them. And Ruby itself is still just version 1.8.6 at this point.

One such project seems to be catching enough wind behind it so that it could drive Ruby into mass (wishful thinking here...) adoption. JRuby.

Now, one might expect that the "J" would stand for Japanese, but remarkably it stands for Java. Isn't that ironic? Ruby is sometimes hailed as "What programmers should be using to still have time for a personal life" contrary to Java's "Write once. Then again, Just one more time... Ok, call your mom and cancel dinner" motto.

Jruby (which just recently reached the 1.0 mark) is a pure Java implementation of Ruby, and it's developed by Thomas Enebo and Charles Nutter with Ola Bini also being credited here and there, and, to some extent, sponsored by SUN. It aims at being more that just another implementation of Ruby (not that there are many...) which means that while still programming in pure Ruby, a coder can now enjoy the following added benefits:
- Java's scaling capabilities since Ruby code now runs inside a JVM which means parallelization in multi-processor setups ;
- An optimized Database connectivity with JDBC;
- Same level of Java's Unicode support;
- Garbage Collection handled by Java. (don't we all appreciate that?);
- A great IDE (Netbeans 6. Packed with all typical goodies plus code completion and a Swing Form Builder, it just might be the VB6 of the XXI century), plus a pretty good one (XCode + a hack);
- Access to those millions of lines of code in Java classes;

And last but not least : Integration. This is the one that's going bring it home.

With Jruby and a rails plugin called GoldSpike (previously rails-integration) we're a simple rake command away from turning any Rails app into a standard WAR file, which in turn can be deployed in either Tomcat or Glassfish or presumably just about any other applet container.

What this means is, in an enterprise environment where you have all these layers (think MVC in different LAN segments) set up and where any innovation is foreseen as potentially disruptive if not outright forbidden, we can easily introduce Ruby and Rails code, and from a manager's point of view its a win-win situation where the developers get things done faster, and the implemented structure is maintained without any hiccups. And they still get Sun's level of support.

In parts II and III I'll be showing some code and examples of rapid deployment with JRuby.

The Automator

I've always been one to dislike repetitive tasks. I think it's partially because I find it hard to concentrate for a long time on tedious chores and partially because I fear getting carpel tunnel syndrome.

Just this weekend my "disability" was put to the test. I found myself going trough 8 GB of assorted files (note to self: do _not_ label zipped backups "stuff"...) trying to find a couple of pictures I wanted my girlfriend to see. I didn't know the filenames (note to self: rename the pictures I like because PIC00731 or DSC00239 aren't real _names_) or the time stamps.

Know, if I was "doing" Windows, I would pull out one of my 50+ lines VBS's, but that wouldn't get me no lollypop. I might had tried a bash-slash-perl trick to move only a couple of selected filetypes onto a new folder, but that wouldn't get me too far either since I would still need at least one more action to open all of them. And my girlfriend would leave before waiting for me to get the script right....

The solution ended up being my new favorite Mac OSX app. Automator.

Automator comes bundled with OSX 10.4 and basically it's a tool that provides you with a way to visually set up a group of actions that get a specific job done. And they call it a workflow, which pretty much sums it up.

Although you would use it to build a program, the programming background needed to use is zero, and the learning curve is neglectable.

After analyzing my specific needs, I came up with this list of necessary steps:
1 - specify the main folder;
2 - get the folder contents, repeating for each of the subfolders;
3 - filter the specified finder items by file type;
4 - decide what to do with them, in this case, I wanted to open the images in Preview so i could see them and find the ones I really needed.

And this was what I got:

Not bad huh?

By selecting and dragging the specific actions from the action list on the left to the right side pane and then changing a couple of options I was done! I saved it as an Application, runned it and 2 minutes later I was seeing the images trough Preview's Slideshow feature.

tiananmen e o "massacre" de berlin. em perspectiva

Fez esta semana anos que estudantes e outros bebados se juntaram numa manifestação sem precedentes na praça de Tiananmen para gritar pelo benfica e lutar pela democracia na china. Também fez anos a Angelina Jolie, mais merecedora de manifestações e apelos, mas muito menos interessante enquanto fenomeno social.

Em Rostock esta semana houve (uma vez mais) confrontos numa manifestação organizada como protesto anti-globalização, o que prova que quase vinte anos depois e a quase meio mundo de distancia, um pais moderno e democratico também consegue atiçar a policia sobre jovens manifestantes e tudo em nome da defesa daquilo em que acreditam. Se não é a ordem e disciplina chinesa, então que seja a democracia capitalista ocidental.


Este semana morreu um blogger, um fotografo, um amigo, um professor, um ser humano de fazer corar de humildade qualquer palerma que se ache com alguma piada ou que julgue perceber alguma coisa sobre alguma coisa.

Não há ninguem que tenha frequentado o IADE (ou que conheça alguém que tenha frequentado o IADE) que não tenha ouvido falar do Prof. Roberto.

A sua perda é irreparavel, mais de 600 comentários no seu ultimo post e a multidão no seu velório ontem á noite dão-me razão. Muitos mais nunca o esquecerão.

morabeza roberto!

On job offers and career management pt II - The end is the beginning is the end

Well, after much consideration and hearing lots of opinions (which I respectfully considered and discarded) I've decided to stay at my current job for now.

You know, sometimes it's not just about the money for me. I would miss the friends I've made (I can't believe I keep calling my coworkers "friends") and I would miss Solaris. And AIX, and Informix and Perl and... and to be completely honest, the offer wasn't all that you know? I mean, I actually heard the words "We only sell Microsoft technologies because if we didn't they would badmouth us to our potential costumers" and _that_ is something I want to stay away from.

And yeah, the title of this post is a reference to "batman and robin", because that's how I feel sometimes when I'm working with likes of "no-time-to-blog"er, penantes, "still offline" sab and "blogui? isso não é da SUN não" alex.

...And I _do_ mean the fellowship part, not the homosexual connoted male in tights thing, ok???

+1

Tuesday Penantes switched.

I'm counting the number of "converts" I've brought into the light ... does anybody know how many I'll need so I get a free toy from Steve?

Some people are just... different!

"As the climate grows more and more desperate for record labels, their answer to their mostly self-inflicted wounds seems to be to screw the consumer over even more. A couple of examples that quickly come to mind:

* The ABSURD retail pricing of Year Zero in Australia. Shame on you, UMG. Year Zero is selling for $34.99 Australian dollars ($29.10 US). No wonder people steal music. Avril Lavigne's record in the same store was $21.99 ($18.21 US).
By the way, when I asked a label rep about this his response was: "It's because we know you have a real core audience that will pay whatever it costs when you put something out - you know, true fans. It's the pop stuff we have to discount to get people to buy."
So... I guess as a reward for being a "true fan" you get ripped off.

* The dreaded EURO Maxi-single. Nothing but a consumer rip-off that I've been talked into my whole career. No more.

The point is, I am trying my best to make sure the music and items NIN puts in the marketplace have value, substance and are worth you considering purchasing. I am not allowing Capital G to be repackaged into several configurations that result in you getting ripped off.

We are planning a full-length remix collection of substance that will be announced soon."

Posted by Trent Reznor, as seen on : http://www.nin.com/tr/default.aspx

FARM project (*)

You might have heard me drool about having helped implement the first Rails app at work.

If you read this blog regularly, you might even know that this was a project done in collaboration with penantes.

Now, what has been missing is an overview of the technology used and a brief explanation thereof.

The project itself is little more that a web-based front-end to penantes's voodoo-like perl scripts and it's purpose is solely of giving interested parties a better view of the spell's script's results.

Well, we had an old Dell Poweredge laying around, so that was the machine used. It had an ancient implementation of Red Hat 8 (actually. I think it was vd who installed it) so that had to go. Not so much because it was old, but because it was Red Hat. And no noticeable services running around so a clean install it would be.

For OS we chose FreeBSD. We wasn't our first choice, but Ubuntu didn't correctly recognize the SCSI controllers and the openSolaris DVD was well...a DVD, and Debian 4 was late. The machine at this time didn't have a working network connection and only a CD drive for media. Since FreeBSD is a distant cousin from both Solaris and Mac (I just had to bring this up) it was the next best thing.

The install was easy enough and the software available was pretty much all we needed.
For web serving we have Apache, for database we used Mysql, and has i've said, we used Rails for development. And apart from configuring Apache with fcgid which is a hole new post subject, everything runs just fine for now.

Recommended reading Rails on FreeBSD wiki page.

(*) in case you didn't notice....
FreeBSD
Apache
Rails
Mysql

27th birthday

My favorite birthday presents:

i can't do what???

09F911029D74E35BD84156C5635688C0

or if you prefer...

0x09F911029D74E35BD84156C5635688C0

On job offers and career management (edited)

Recently i've been reading a fellow *'s musings on job searching and expectations and focus on career management, and although I mostly agree with his opinions and objectives, I can't stop but wondering if I (or most people, for that matter) can afford to be as straightforward as he seems to be.

In my career, and up until some 6 months ago, I've been mostly involved with Microsoft products and technologies. I've developed, administrated and and maintained applications, databases, systems and networks. However, Linux and Open Source in general have been my hobby and, i dare say, passion for the last 8 years or so. Cutting a long story short, in a Windows world I'm (somewhat) highly valued, but in a Unix\Linux context, I'm bound to be considered a junior staff member for a couple of years more.

Now, if the job title doesn't really bother me, the difference in wage is staggering. Enough to make me consider a jump back.

All this is only important when I'm faced with a difficult decision like I am right now.

I've managed to get a good deal of respect and appreciation on my current job, I've been involved with some very interesting technologies and have been given the chance to use Open Source technologies and am currently in the process of finishing up my first professional (cof...cof...) Ruby on Rails application, but the wage is ridiculous.

On the other hand, I have an offer to get back to a development only a sysadmin only position, but using .Net and other mostly Microsoft technologies. The pay is good, the challenge is well, challenging and the work environment as far as I could gather so far is very good. On the downside there will be plenty of grey suits and ties in my future. And a senior colleague who thinks rails is amateurish. But the boss says I can use whatever technologies I see fit to get the job done. And they both actually read my resume. And want _me_ to work for them.

Well, as you might have guessed the wage is the only thing that's making me consider the change, and the love for open technologies the only thing thats keeping me back.

In a ideal scenario I would refuse the change hands down, but these are not ideal times, so I'll have to sleep on it and hope for the strength to make the best decision.

Well things change quickly when you let them. There was a sysadmin position available too, and although I refused the developer job, I'll most likely be accepting the later. Stay tuned....

If only we had known earlier...

As seen on The freedom blog...

"Linux hackers! They aren’t smart enough to scare Bill Gates… and they certainly aren’t smart enough to scare Jesus. Did you know that He protects this website too? I prayed it, and it happened! All attacks rebuffed! All sin kept far from these pages.
Thank you Lord!"

By the way, did you know that if you use Ubuntu Christian Edition you can stop daemons with the command "Exorcize!" ? And that you can use "bless" whenever a program fails to start? Just beware not to issue a "chmod 666" , or you'll go to hell!!

Oh @wathever, forgive them, for they are funny. Seriously, I thought that sarcasm was beyond americans.

What caught my eye this week

Brand of the year:

Google, witch you know already so I wont link to their site, was recognized this week as the the world's top-ranked brand.

In only 10 years, Google's Sergey and Lary managed to top decades old brands such as General Electric, Coca-Cola or even IBM.

Entering a realm occupied by only a few other companies whose brand became a synonym with their product (think Gillette) Google is an example of entrepreneurship. If you doubt it, you can always google it up. :o)

Blog of the month:

Following a tip from a new friend I've been enthusiastically reading a blog from a fellow rubyist. It's called Ruby on Windows, and as you might guess it's about using Ruby as a scripting and automation tool on MS Windows OSs. It provides some great examples and code samples witch got me thinking about replacing my vb scripts at work.

This is a great example of how to integrate an open technology with a closed system.

Year Zero. A final surprise?

Year Zero, Nine Inch Nails new album was officially released today. And a few more surprises came with it.

After hearing it on repeat for about 3 hours, when i finally removed the cd from my macbook, the CD had turned from grayish into white revealing some binary code that (after some googling) "I" discovered could be translated to a link to another secret site!

And i though that it was just my macbook going _Extra_ hot this time!!

This is the beginning....

What is it about the 19th of April?

Red Hat Storage Management
Indie Lisboa
Linux 2007
E-MKT 2007

And what about the rest of us who don't have the gift of ubiquity?

Old School To-Do List

I figure that if I write down my tasks, I'll be forced (by punishment of public embarrassment) to _really_ do them. This will hopefully get me out of LMP(*) and into GTD mode.

To Do:
- Install Edubuntu on a old iMac G3 to offer as a birthday present to my 6 year old cousin;
- Finnish reading Everyday Scripting with Ruby;
- Create a script to automate data extraction and transformation and creation of Excel graphics at work;
- Replace a myriad of Judoscript, Groovy, bash and Perl scripts with well documented Ruby scripts at work (It will look good in my resumé.. "the guy who introduced #a banking institution# to ruby");
- (finally) Take the admission exams for College;
- Help in the translation of www.ruby-lang.org to Portuguese;



(*)LMP .: Last Minute Panic - the major driving force for lazy creative geeks :o)

The begining of the end (of record labels)

Nine Inch Nails made their _entire_ album available on their website!
Even the almighty RIAA can't stop them now

Art is resistance!

Perl Tech Meeting

Yesterday I went to my first Perl Tech Meeting and I can't stress enough how geeky those guys are.

Having lots of easy going, funny intelligent people talking about something they like is always fun, but this was actually very informative, since there were some tech talks that covered areas such as better debugging, replacing bash with perl, using C to improve Perl scripts benchmarks (dam, this guy was awesome!).

I specially enjoyed meeting Francisco Cabrita hearing Miguel Duarte and José Castro and some others whose names elude me right now.

Anyway, thanks to SAB(offline for _way_ too long) and Penantes for the invite.

May the Camel be with you!

Free tech support

One of the nicest things about being involved with customer support is being able to hear in first hand _real_ users fears and doubts.

Today i received an e-mail (at work) from a customer contemplating "migrating to a Ubuntu / Firefox solution" (his words) from Windows / IE and he was wondering if it would be safe to use our on-line banking service.

Yes it is. The only side effect is that the web app will work better in Firefox.

And since I am in a good mood, I will send him my personal e-mail for any tech support questions he might have in his migration.

It feels good to help a customer. :o)

Long time no see

I was forced to observe the shutdown day for over a week (not really, but i'll get back to that) because my Macbook died on me.

It's never a good experience to be away from your mac, but to deal with the Apple support around here one must be prepared for the worst.

From telling me that the customer service guy wouldn't reply my e-mails because he had personal problems (hey that's funny,i have a personal problem too! MY MAC IS BROKEN! what a coincidence) to taking some 20 phone calls to finally get some answers (I have witnesses. And they're still laughing) i've seen it all with these guys.

If we consider that a large part of Apple sales come from mac owners showing off the “superior hardware and the user experience a mac gets you” to their friends and coworkers (I myself am responsible for at least 4 switchers over the past 6 months), one should expect a better level of emphasis on customer satisfaction right?

Thankfully I still have my trusty Asus laptop that managed to deliver the daily fix of web surfing, and getting most of my work done so I really didn't had to be offline for so long. I was just too negative to write anything useful.

Anyway the XVI Jornadas de Informática an event hosted at UBI went by, and this year at least I heard something about what happened there. In Ruby in Portuguese website there are even some of the presentations given there available for download.

My humble 2 cents however would be to manage to get some more publicity before it happens.

While on the subject of great events happening in this little
fascist square of dirt by the sea, the fifth national encounter on Open Technologies will be happening in Lisbon on the 19th, and although the organization is hosted by Sybase and seems to be very professional and extremely interesting, my favorite Solaris Admin - slash -Farmer boy already managed to find a bug on the event page.

Also, today I'm going to my first Perl Mongers tech meeting and I'm hopping that I'll be able to learn something from those guys, 'cos the Perl I know wouldn't move the proverbial mountain.