And now for something completely different...
yes i am alive. some news to follow....
"I don't mean to sound bitter, cold, or cruel, but I am, so that's how it comes out" (Bill Hicks)
yes i am alive. some news to follow....
Tags: fun, johnny's back
It's time to party like it's 1234567890 – 'cause it is! In Unix time at least.
Apparently a much lesser celebration is also taking place now, Valentine's Day. So if you didn't understand the first sentence in this post Happy V-Day, if you did you probably don't have a girlfriend anyway so never mind.
This is the original performance that got CENSORED in '93 from the Letterman show. On January 30 2009, 16 years later, it got aired. Finally.
Enjoy.
Tags: censorship, fun
Nas palavras imortais do BB Marco "Nao sei o que andas a procura, mas arriscas-te a encontrar" (Possivelmente a frase nao sera tao imortal quanto isso, uma vez que nao tenho a certeza da citacao estar correcta)
A ideia nao e nova, mas lembrei-me de ver o que e que os desocupados que aqui vem parar andam a procura.
copy run start - Experimenta sem o t no fim. Se correr bem copias a configuracao actual do teu Cisco para a memoria de maneira que no proximo reboot elas nao sao esquecidas.
"list of things white people like" - Isso e aqui
0211fb618b98d794165ceb6dc8f38fbb7d260c1d28dcffc5dd70938fd723222e574ef558f1939482 - Oi?
codigos para desbolquear canais para adultos na meo - (E cerca de 100 variacoes desta query) Experimentem paga-los. There is no such thing as free pr0n.
meo ver conteudos gravados na segunda televisão - Tens de desligar a primeira. Parvo, nao e?
como limpar a cache do teu browser - Do meu? Basta pedires.
o significado segafredo em italiano - Punheta a frio. Ajudou?
what does omoos mean - Se for humus, ve aqui Se for Omoo, E um livro do Herman Melville, sequela do Typee. No meu blog e uma referencia aos comentadores.
Krav Maga - (e referencias a tecnicas, Paulo Pereira etc) - Gosto muito. O mestre Paulo foi das pessoas que mais me marcaram ate hoje (e nem tou a falar das nodoas negras). Para informacoes mais serias procurem aqui ou aqui
*homenagem a uma das minhas blogueiras favoritas. Hey, they say it's the highest form of flattery. Right?
Not too long ago I was reading some forum or wickedly long e-mail thread (can't remember) and someone mentioned that referring to Microsoft as M$ was immature or something close to that point.
Well I disagree. I think most people that use the M$ thingy do it because they've grown so used to checking for files with DOS line endings with grep -lR -e '^M$' *
that they just associate DOS with M$... I mean Microsoft. Wait, I'm confused here.
Because I recognize we all live in troubled times, I've decided to share some financial advice I got recently from one of my company's admins*.
If you had purchased £1000 of Northern Rock shares one year ago it would now be worth £4.95 . With HBOS earlier this week your £1000 would have been worth £16.50.
£1000 invested in XL Leisure would now be worth less than £5 but if you bought £1000 worth of Tennents Lager one year ago, drank it all, then took the empty cans to an aluminum recycling plant, you would get £214.
So based on the above statistics the best current investment advice is to drink heavily and recycle.
*actually it was a NT Admin
Ok, quickie, did you tough that NIN's latest single had a Meathead <-> disco dancing vibe to it? -Well, they seem to agree. Trent posted this wonderful fan art and called it the official video!
Enjoy you guys. I'm going to the beach. (more on this later)
Lay sunday, oh lazy sunday..
Well, to cheer me up on a lazy sunday nothing better than a personality test. This one I got compliment's of Restelo, a portuguese blogger who also relocated recently and whose blog I'm a devoted follower (Oh, her blog is in Portuguese, so....)
So, as I was saying, this test, PersonalDNA was actually one of the funniest I tried so far, and attributing me a result like "Generous Leader" how can it be wrong? Yes, "Glorious Leader" would be a stretch...
Unfortunatly, it only gives you a little badge as a reward, but I took a snapshot of the full personality trait chart, so here it is:
Short code post. Just the story of how do you get someone looking into Ruby when they had already dismissed it as a fad. You know, the hype can blind you.
So the situation arrived when a friend needed to have a particular chunk of XML repeated 1000 times. No more, no less. Sounds stupid but it's just an oversimplified anecdote.
When he asked me for a quick script to do it for him, I saw an opportunity to show how Ruby would be a good tool for this job (insert promo here). Being a "show, don't tell" kind of guy, this was the code I presented him.
def thousand_repeater(string, repeats =1000)
repeats.times do
print "#{string}\n"
end
end
Ex.: thousand_repeater "hello",3
for(i=1; i<1000; i++)
Need help explaining your children why there is a server in the house?
This will help.
What an exciting week this has been!
We started of with a native Mono release for OS X, which you can read more about at Miguel's blog.
Then it was Netbeans 6, which is IMHO the best IDE for Ruby and Rails development and it's yours for free. Here.
And today we can rejoice at the launch of Rails 2.0.
Hurray for us!
On a side-note, I just wanted to share with you a conversation I had with a mono hacker regarding the look of Mono on Mac OS X, even if in a somewhat twisted way for better reading :
Me > People are complaining it doesn't look "native".
She > Well, there are two answers for that:
Novell is currently concentrating on making Mono on the Mac a stable development platform. The System.Windows.Forms layer has support for theming and we could accept contributions for a Quartz theme that uses the HIToolbox APIs. Or, in a shorter version, we accept patches.
And then she said goodbye with the funniest tagline I've heard this week :"nothing like a linux forum to complain about how a windows technology looks on a mac"

Prémio mais votado pelo publico
sapo frogger - Pedro Cardoso
(com as minhas desculpas pelo erro.)
Prémio Ideias
bookworms - Pedro Sousa
Prémio Remix
sapo boavida - Luis Rei e Samuel Martins
Prémio Geek
Bruno Pedro
ei esta malta é (quase) toda do Prt.Sc !!!!!
Parabéns a todos!
...e o resto já não ouvi. Já só tinha ouvidos para os Wraygunn !
This is a somewhat old story that I've read some time ago. It came up today in a conversation I was having with some co-screenies.
I had to do some googling, but was able to find a good enough recount of the story. Read it here.
We're just 10 days away from Toad CodeBits.
This promises to be the biggest gathering of 'tuga* code monkeys this year and I'm looking forward to being there. Although, come to think of it, I don't know if I'll actually make it. The thing is, it seems that you have to both register for the event and then make some sort of announcement and hope that you make the final cut.
That last bit seems to be a problem for me, 'cause I really don't like Sapo (the company, the search engine, the portal, the....) at all. But since I have to admit that I would really like to be there, here it goes....
If I manage to get in, I'm looking forward to hearing Mike Culver from Amazon, Marco Gonçalves (on the BSDs) and hu... wraygunn
* 'tuga is slang for Portuguese.
My girlfriend's sister asked for help. But all she got was a 16.
The purpose of this script is to get a file(name) as a first argument, a regexp as a second argument and then search trough the file and print out the whole sequence where any of the possible regexp values are found, being that the searched sequence itself must be identified with "<>" symbols and then do a little basic math with the elements we've found.
To try this out, save the following as (for instance) sequences.txt:
>50c's and 50t's
cccccccccccccccccccccccccccccccccccccccccccccccccctttttttttt
tttttttttttttttttttttttttttttttttttttttt
>10G's and 90A's
GGGGGGGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>A random sequence
ccagtcctgtctaaggactttggttcatgcgttaatttcggttagccagtggcgcccacg
taacaaagtgcgaccgacctgcttccatagcattgaaatgtccttgattggagattttac
gcaggaggactgataagttcgggtctgaattgatgcagcgaacgttcatccaatactcag
acttgcactcagtcg
>A second random sequence
cgcatgacggccctcctcgacggttcattaaccttgcacaccaactgttcctcaaccgat
ctggtgtctttctcacttacatagcagttgctgtaccatttgatgggaacccgagatcac
cgggttatcgcgggagtttattccgaattgttctcggaaatgtggcgtcggcttgaattg
ggaataatacggatcttgacaagcacgatttcatccacaatgcggcacgagtaatcccct
tctggaaggatgcagaaaggacatatacaatgagctagccacgtggcgcataacgcagct
tggttagaaactaaatctatacaggaagatacagaatgggaacagtgtcgctcagtctag
ccagctagatccgcctttagtcgaccttaggggtaaggca
And the below code as scripty.pl:
print "\n\n *girfriends_sister_school_id* \*girfriends_sisters_friend_school_id*\n\n";
print "filename:\n";
$filename =
open(TEMPFILE, $filename) or die("Cannot open the file $filename");
print "Insert the regular expression to find:\n";
chomp($regexp=
while (
if ( /^>/xms) {
$paragraph = "";
$paragraph_head = $_
}
if ( /^$/xms) {
push @paragraphs, $paragraph;
} else {
$paragraph .= $_;
}
}
push @paragraphs, $paragraph;
foreach (@paragraphs) {
while ( $_ =~ /($regexp)/gi) {
$expressions{$1} += 1;
}
}
foreach $key (keys %expressions) {
print "\n\nPattern = $key\n";
foreach (@paragraphs) {
if ($_ =~ /$key/) {
$paragraph_with_patterns = $_;
$total = length$paragraph_with_patterns;
$counterA = 0;
$counterC = 0;
$counterT = 0;
$counterG = 0;
if ($key =~ /a/){
while ( $paragraph_with_patterns =~ /a/gi) {
$counterA += 1;
$sum1 = ($counterA/$total);
}
}
if ($key =~ /c/){
while ( $paragraph_with_patterns =~ /c/gi) {
$counterC += 1;
$sum2 = ($counterC/$total);
}
}
if ($key =~ /t/){
while ( $paragraph_with_patterns =~ /t/gi) {
$counterT += 1;
$sum3 = ($counterT/$total);
}
}
if ($key =~ /g/){
while ( $paragraph_with_patterns =~ /g/gi) {
$counterG += 1;
$sum4 = ($counterG/$total);
}
}
$paragraph_with_patterns =~ s/($key)/\<$1\>/gi;
print "$paragraph_with_patterns\n\n";
%sum = ();
%sum1 = ();
%sum2 = ();
%sum3 = ();
%sum4 = ();
if ($counterA >0){
%sum1 = ("A", $counterA);
}
if ($counterC >0){
%sum2 = ("C", $counterC);
}
if ($counterT >0){
%sum3 = ("T", $counterT);
}
if ($counterG >0){
%sum4 = ("G", $counterG);
}
%sum = (%sum1,%sum2,%sum3,%sum4);
foreach $key_id (sort hashValueDescendingNum (keys(%sum))) {
$div = ($sum{$key_id}/$total);
print "$key_id = $sum{$key_id} \/ $total = $div\n";
}
}
}
}
sub hashValueDescendingNum{
$sum{$b} <=> $sum{$a};
}
exit;
Then run perl scripty.pl . Put sequences.txt as the file and a[c|t]g as the regexp when prompted.
I had alot of fun doing this wich is a good thing since I didn't get paid.
And no, neither bio::perl, nor any other module for that matter, were options.
Finally, a major thank you must go out to sab for the priceless (as in: he didn't get paid either) help.
Tags: fun, geek, perl, programing
Well, after much consideration and hearing lots of opinions (which I respectfully considered and discarded) I've decided to stay at my current job for now.
You know, sometimes it's not just about the money for me. I would miss the friends I've made (I can't believe I keep calling my coworkers "friends") and I would miss Solaris. And AIX, and Informix and Perl and... and to be completely honest, the offer wasn't all that you know? I mean, I actually heard the words "We only sell Microsoft technologies because if we didn't they would badmouth us to our potential costumers" and _that_ is something I want to stay away from.
And yeah, the title of this post is a reference to "batman and robin", because that's how I feel sometimes when I'm working with likes of "no-time-to-blog"er, penantes, "still offline" sab and "blogui? isso não é da SUN não" alex.
...And I _do_ mean the fellowship part, not the homosexual connoted male in tights thing, ok???
Tags: fun, jobs and career, me