open mind open opinion

top of the tops 2010

2011-01-01T20:16:00.003+01:00

Without doubt 2010 was a personal best year for yours truly here.

There were many good moments, some great moments and I can't remember that many bad things that are worth remembering. Except for a company called Kanon in The Hague, but that's just a drop of shit in an otherwise perfect ocean of good things, sure it looks terrible but it gets diluted somehow... I hope.

Looking a bit further away than my pretty pierced bellybutton, I made a little list of some of the best things of the year that just passed from all the fields that I cared about. I had some fun doing it, so I hope you enjoy reading it too.

- Top Sports Moments
World Cup South Africa final
Benfica winning the Portuguese title

- Top Gadgets
iPhone 4
Android OS

- Top WTF Moments
The omnipresent sound of the Vuvuzelas
BP Oil Spill and the (lack) of real repercussion

- Top Technologies
Azul Zing
EMC vBlock

- Top Dream Cars
Nissan GT-R SPEC V
Porsche Panamera Stingray

- Top Games
FIFA 11
GT5
MW Black Ops

- Top Movies
Inception
Machete
The Social Network
Black Swan

- Top TV Series
Dexter Season 5

- Best albums
The Social Network OST (Trent Reznor and Atticus Ross)
Jonsi - Go

Goodbye Amsterdam

2010-06-30T03:15:00.001+02:00

All good things come to an end sooner or later.

Devoxx (half)day 2

2009-11-17T18:50:00.005+01:00

First talk of the day:
java ee 6 platform
- java ee 6 and Glassfish 3
- history
- new features of jee6: jax-rs, jcdi, @inject, bean validation, interceptors, managed beans
- less xml
- pruning of jax-rp,c jax-r and entity cpm 2.x (jee 7 might kill them totally)
- ejb lite
- managed beans 1.0
- jpa 2.0 annotations (are cool)
- servlets 3.0
- ejb 3.1
- live coding again (have I said how cool this is?)
- jsf 2.0 (mojarra)

Second talk of the day
SOA in practice
- loose coupling is not always an answer
- technical driven vs business driven services
- esb is not always an answer
- meet the SOA stack
eam + bp + esb/web services + services (business driven self contained interfaces)
- conway's law

organizations which design systems ... are constrained to produce designs which are copies of the communication structures of these organizations

- satir change model

- you can't buy SOA
- reuse is not a valid business case for SOA
- distributed process development brings added costs
- SOA needs to be supported from the top down and established from the bottom up

Whoa… that was heavy! Very nice presentation from Nicolai Josuttis (I even ran to buy his book afterwards).

In unrelated news… 2 days. That's how long my project lasted without me. I am going back to the office tomorrow to help fight the chaos demonstrated in the graph above... but hopefully will be present in the last 2 days of the conference!

Tot ziens!

Devoxx day 1

2009-11-16T09:41:00.012+01:00

First victory: Got here on time despite the dutch traffic early in the morning.

First talk of the day:
jBPM in Action
Introduction:
- What are business processes;
- History.. hey it started in Belgium (humm figures);
- What is BPM and jBPM in particular;
jBPM Concepts
- BPMN 2
- BPEL 2
Demo Examples
-(cool, live coding :-D)
- how to configure Eclipse for jBPM4
- custom activity types.. nice!
- (should I have been in the cloud computing session instead? well, RH did pay my ticket…)
What's next
- Insame amount of new features in the incubator

Second talk of the day:
SOA, OpenESB and OpenSSO Programming with Passion
- Based on http://www.javapassion.com/soaprogramming
- WSDL
- BPEL
- JBI
- openESB
- Java EE Service Engine
- IEP
- EDM
OpenSSO
- SSO within an enterprise

Third talk of the day:
The Jungle of the Web - A Way to Survive by Detecting Fast Flux Botnets
- botnets
- different flux types: single, double, hydra flux
- detecting fast-flux botnets
- fluxy a tool to help detect fast-flux botnet

Fourth talk of the day:
The Next Generation Profiling and Diagnostics Tools
...
Ok, this turned out to be just a pitch for Oracle's JRockit toolset which made it pretty useless for me. As far as alternative JVM's go I'll stick with Azul. :-D

Still, I have to admit that the Mission Control toolset is pretty impressive, and the promised new features in the upcoming version 4 are making me think on how I can fit this in my Architecture.

BOFs
Unfortunately I am too tired to attend. I would have enjoyed this one and specially The Java tuning puzzlers talk. A well, I'll have to check the screencasts when they come up.

Tot ziens!

Busy week ahead

2009-11-15T16:07:00.008+01:00

It's going to be a really busy week for me!

First of all I'm going to Devoxx in Antwerp which is one of my favorite cities in Belgium.

There will be Conferences, BOFs, talks about Clouds, BPM, Scala, Architecture, SOA, Java…

Well, I think the logo correctly expresses the absolute ehhh.. mesh(?) that this conference is going to be.

Second of all, there will be an update to the platform @work early Monday morning which I will have to support remotely.

This should prove to be an easy task, but still..

Last but not least, the final stage of my first *BIG* project as an IT Architect is also starting this week. Hurray for me, it seems to be going better than anticipated!

As a personal (added) challenge, I am trusting some colleagues to be able to follow my project plan and deliver the results in time and with quality. Delegating as never been my strong point, but this is how confident I am right now.

Well, that's it for now, I will keep you posted on significative developments.

Tot ziens!

Gran Turismo 2009

2009-09-13T02:07:00.009+02:00

So I've bought a little car and decided to take a tour of central europe for this vacation.

View Larger Map

I have decided on the way there, but not on the way back.. So far, I have spent a night in Hanover and got to Berlin a couple of hours ago. From what I've seen so far, Berlin is one of the most beautiful cities I have been in. It's nightlife is very diverse and there seems to be a little bit of something for everyone, just like home (eheh) but with a twist that makes it very different from the night in Amsterdam. It's still hard to explain the differences but I like it here more than I had anticipated

this is in Hanover....

and this is in Berlin....

and by the way, this is my little car (actually.. mine is black, but you get the picture)

*All images courtesy of Wikipedia because I'm a terrible photographer

And now for something completely different...

2009-09-13T02:00:00.001+02:00

yes i am alive. some news to follow....

Iceland pics

2009-03-31T11:39:00.005+02:00

Because I promised them last year. You can find more in my Facebook page, so feel free to ~~stalk~~ add me there.

Amsterdam.rb meeting tonight

2009-02-23T13:52:00.003+01:00

Location
The event will be held at the Amsterdam office of TTY Internet Solutions, which you can find here

Schedule
19:00 - doors open
19:30 - Jeroen van Dijk - UML-based scaffolding
19:50 - Martijn van Excel - openstreetmap.org
20:20 - break
20:35 - Ola Bini presenting Ioke
21:10 - TTY - About quality
21:30 - break
21:45 - Phusion's Ninh Bui & Hongli Lai - design by contract
22:10 - Axel Roest about rubycocoa
22:30 / 23:30 - drinks

This will be a exciting night out for ruby geeks in Amsterdam! I look forward to see and hear Ola Bini and the Phusion crew above all others.

I will try to write a post-meeting post with any interesting stuff that comes out of it. Stay tuned...

Let's party like it's 1234567890

2009-02-14T00:31:00.001+01:00

It's time to party like it's 1234567890 – 'cause it is! In Unix time at least.

Apparently a much lesser celebration is also taking place now, Valentine's Day. So if you didn't understand the first sentence in this post Happy V-Day, if you did you probably don't have a girlfriend anyway so never mind.

Real men don't dance

2009-02-01T10:40:00.004+01:00

This is the original performance that got CENSORED in '93 from the Letterman show. On January 30 2009, 16 years later, it got aired. Finally.

Enjoy.

Fuck Christmas, I got the Blues

2008-12-21T13:54:00.003+01:00

This year I'm spending Christmas away from everyone I love.

Of course this is not the highest point of my life, but to be fair... I am going to be in Iceland seeing waterfalls, volcanoes, glaciers, whales, fjords, geysers and IF I'm lucky enough I might even catch a aurora borealis in a polaroid for posterity. All this while listening to a lot of Bjork and Sigur Ros.

Also, I will be riding a snow mobile, learning about the ancient myths of one of my favorite civilizations (wait.. vikings where a civilization, right?) drinking cheap vodka in expensive places and finally relaxing in either the sauna or the jacuzzi or even in front of a king size plasma TV in one of the most beautiful hotels I've ever seen.

I will do all these things with a cute geeky girl that has more piercings and tattoos than me (and it's getting increasingly difficult to find one... eh..).

But you know it and I know it... she's not you. Is dat een leuke ding?

Book meme

2008-11-12T12:13:00.003+01:00

The query shown earlier on V$LOGFILE demonstrates an OFA-compliant naming convention for redo logs.

* Grab the nearest book.
* Open it to page 56.
* Find the fifth sentence.
* Post the text of the sentence in your journal along with these instructions.
* Don’t dig for your favorite book, the cool book, or the intellectual one: pick the CLOSEST.

Revelations

2008-11-06T01:31:00.004+01:00

People ask me where I stood politically you know. It's not that I disagree with Bush's economic policy or his foreign policy. But that I believe he was a child of Satan here to destroy the planet Earth.

Bill Hicks

I think I can take the stage today and speak in the name of the whole civilized world and say "phew..."

Obviously nobody knows what the election of Mr. Obama will actually mean to all of our futures, but it is clearly a sign that people believe in change. People long for change. We hope that this is a first step towards change.

Personally I will be very happy if by the end of his first term, America has a economy again. Extra points if no other third world country is invaded and double that if somehow some sort of foreign policy that involves stopping the embargo on Cuba, supporting developing nations with food, medicine and technology instead of weapons and money in the hands of right wing soon-to-become-if-not-yet tyrants is put in place.

In all honesty, I'll be fine if at least we have to try hard to make a good joke about the new government in the States, 'cause god knows that this last couple of years they've made it far too easy for us.

PS.: Here's a link to Bill Hicks famous "Revelantions" set for your entertainment pleasure. Now, go back to bed America.

slow day

2008-11-04T23:27:00.001+01:00

Google passa a batata quente*

2008-10-04T22:01:00.000+02:00

Nas palavras imortais do BB Marco "Nao sei o que andas a procura, mas arriscas-te a encontrar" (Possivelmente a frase nao sera tao imortal quanto isso, uma vez que nao tenho a certeza da citacao estar correcta)

A ideia nao e nova, mas lembrei-me de ver o que e que os desocupados que aqui vem parar andam a procura.

copy run start - Experimenta sem o t no fim. Se correr bem copias a configuracao actual do teu Cisco para a memoria de maneira que no proximo reboot elas nao sao esquecidas.

"list of things white people like" - Isso e aqui

0211fb618b98d794165ceb6dc8f38fbb7d260c1d28dcffc5dd70938fd723222e574ef558f1939482 - Oi?

codigos para desbolquear canais para adultos na meo - (E cerca de 100 variacoes desta query) Experimentem paga-los. There is no such thing as free pr0n.

meo ver conteudos gravados na segunda televisão - Tens de desligar a primeira. Parvo, nao e?

como limpar a cache do teu browser - Do meu? Basta pedires.

o significado segafredo em italiano - Punheta a frio. Ajudou?

what does omoos mean - Se for humus, ve aqui Se for Omoo, E um livro do Herman Melville, sequela do Typee. No meu blog e uma referencia aos comentadores.

Krav Maga - (e referencias a tecnicas, Paulo Pereira etc) - Gosto muito. O mestre Paulo foi das pessoas que mais me marcaram ate hoje (e nem tou a falar das nodoas negras). Para informacoes mais serias procurem aqui ou aqui

*homenagem a uma das minhas blogueiras favoritas. Hey, they say it's the highest form of flattery. Right?

Short explanation on the "M$" thing

2008-10-04T16:31:00.001+02:00

Not too long ago I was reading some forum or wickedly long e-mail thread (can't remember) and someone mentioned that referring to Microsoft as M$ was immature or something close to that point.

Well I disagree. I think most people that use the M$ thingy do it because they've grown so used to checking for files with DOS line endings with grep -lR -e '^M$' *
that they just associate DOS with M$... I mean Microsoft. Wait, I'm confused here.

oh gowd.. fail

2008-10-04T14:22:00.003+02:00

I might get a bad rep for this one.. but hey all good fun!
http://www.blackboard.com/projectng/ads/video.asp?id=MichaelandWoz

Short description:
Michael Chasen and Steve Wozniak talk about Blackboard 9 (project NG) in a "I'm a PC, I'm a Mac" kind of (read: ripoff) commercial. Seriously now.. Wouldn't hiring some once-great-stand-up-comedian make more sense here?

Spoiler:
Watch the other adds. It gets worse.

Finantial advice

2008-09-25T15:15:00.005+02:00

Because I recognize we all live in troubled times, I've decided to share some financial advice I got recently from one of my company's admins*.

If you had purchased £1000 of Northern Rock shares one year ago it would now be worth £4.95 . With HBOS earlier this week your £1000 would have been worth £16.50.

£1000 invested in XL Leisure would now be worth less than £5 but if you bought £1000 worth of Tennents Lager one year ago, drank it all, then took the empty cans to an aluminum recycling plant, you would get £214.

So based on the above statistics the best current investment advice is to drink heavily and recycle.

*actually it was a NT Admin

In repeat

2008-09-04T00:28:00.002+02:00

Some people need to be constantly reminded that the world turns around itself and so should they.

Saturday Summer Sail (UPDATED)

2008-08-18T20:39:00.003+02:00

Unfortunately it will be a dutch summer...

But I will update this post with some photos!

Oh happy days

2008-08-17T20:56:00.007+02:00

Ok, so I went to Den Haag this Saturday just to leave Amsterdam for a bit. And in a good time did I do so. If you don't know already, The Hague (as it is also referred to) is the capital of Holland and one of the most beautiful cities I've ever been.

Even I could pass laws with that view..

If you ever get to go there be sure to visit the big church (Grotekerk) and the parliament house. Really very nice. Also, while in the neighborhood be sure to check the cool shopping district, specially the "Passage". At one end you will find the iFactors Apple Retail Store where you can just walk in and buy an iPhone (at this moment, the iPhone is sold out everywhere in Amsterdam, this is why I was surprised of just going into a store and getting out with one in less than one hour)

It's that one to the right!

So, cutting a short story shorter, I am now a proud owner of a black 16 GB 3G iPhone. Hurray for me!

I still haven't played enough with it to make up my mind if this was actually a good buy or just a long time fetish that I could finally obtain (god knows I've had this doubt in my mind for several other items...) but so far, with the help of some really cool free apps I've been having a blast with it. At the very least it will replace my old iPod in my pocket everyday.. not sure if I want to give up my "normal" much lighter, much smaller phone yet.. And the PSP might stay at home more often, at least for those short train trips it's not worth the bother anymore since I'm not even that much of a player...

Either his hands are bigger or his iPhone is smaller...

Ich wuenschte du waerst mit mir da gewesen

2008-08-03T11:20:00.005+02:00

Some pics from the Amsterdam gay pride night out. Lekker dings all of us, i know.

you call _that_ dancing

andy comes out (a bit)

lekker lekker lekker

Major Matze and his woman

choose what life?

me and Connie

Thanks for the (good) photos Matze.

Now all I need is time.

2008-08-01T01:39:00.000+02:00

So this is permanence, love's shattered pride.
What once was innocence, turned on its side.
A cloud hangs over me, marks every move,
Deep in the memory, of what once was love.

Oh how I realized how I wanted time,
Put into perspective, tried so hard to find,
Just for one moment, thought I'd found my way.
Destiny unfolded, I watched it slip away.

Excessive flashpoints, beyond all reach,
Solitary demands for all I'd like to keep.
Let's take a ride out, see what we can find,
A valueless collection of hopes and past desires.

I never realized the lengths I'd have to go,
All the darkest corners of a sense I didn't know.
Just for one moment, I heard somebody call,
Looked beyond the day in hand, there's nothing there at all.

Now that I've realized how it's all gone wrong,
Gotta find some therapy, this treatment takes too long.
Deep in the heart of where sympathy held sway,
Gotta find my destiny, before it gets too late.

Joy Division - twenty-four hours

By the way, and because I don't like anyone to feel bad for me... This past few nights I've had the very best time in a very long time. Thank you Siouxie. Getto rocks! Amsterdam rules!

Let's get the party started!!!!

help me i'm in hell

2008-07-29T20:29:00.004+02:00

My kitchen is dirty as hell.. i swear i can hear voices that are either satan trying to tell me something, or the plumbing needs fixing.

há 12 anos

2008-07-29T01:08:00.006+02:00

... tinha eu 16 anitos. Lembro-me que acreditava piamente que havia muito mais para lá da realidade palpavél. Do quotidiano. Do mundano. Dizia saber que a realidade não era a verdade. A verdade esconde-se sempre por trás do que conseguimos (ou queremos) acreditar, daquilo a que chamamos "a nossa realidade".

Other planes lie beyond the reach
Of normal sense and common roads
But they are no less real
Than what we see or touch or feel

Como é que eu me esqueci disso, é um misterio. Porque é que eu tive de ser recordado agora, é o destino.

The lyrics of Shortbus pt II

2008-07-18T22:40:00.000+02:00

Is you is or is you ain't my baby
Well, the way you're acting lately, well it makes me doubt
You were still my baby, baby
But it seems like my flame in your heart, well it's just gone out

A man is a creature
That has always been strange
Just when you're sure of one
You'll find that he's gone and made a change

Is you is or is you ain't my baby
Well, maybye my baby found somebody new
Or is my baby still my baby too

Anita O'Day - Is You Is Or Is You Ain't My Baby?

The lyrics of Shortbus pt I

2008-07-17T22:23:00.002+02:00

I walk a tight rope
and live with a high hope
that somehow we still feel the same
through this catastrophe it's quietly telling me welcome that first word again

I don't care if the worlds upside down if you're lost or you're found
I know your feet will stay far from the ground
If you just stick around

I know the shots you call gentle
cause I could fall and break
you'll hear what they say

I read between the lines
It's just like a hate crime
And tell me the dateline today

I don't care if the worlds upside down if you're lost or you're found
I know your feet will stay far from the ground
If you just stick around

Scott Matthew - Upside Down

Things white people like

2008-07-11T21:12:00.000+02:00

I just found out this morning that I'm a cliche. To be more precise, I'm a white guy.

Reading trough the list of things white people like I had 61 hits out of the 103 items.

Among the ones that I felt mirrored my own tastes, I would point out the following based on accuracy or just how funny their importance to _me_ is described.

# Film Festivals
# Coffee
# Diversity
# Asian Girls
# The Daily Show/Colbert Report
# Indie Music
# Apple Products
# Living by the Water
# Irony
# Vintage
# Japan
# Modern Furniture

Funnily enough.. they forgot indie cartoons.

BTW, do you know these guys?

We drink and dance and smoke and die of a stroke

2008-07-07T09:00:00.000+02:00

... living like steamers, some sirens screamed and we started singing: nous sommes derrangés toujours par des mirages, mais ça fait réver plus, ça donne du courage! Jungle life is quite absurd if you haven’t got a knife!

Mais letras de JPS aqui

Ah well... you know...

2008-07-07T00:00:00.000+02:00

Ich hoffe dass diese Nachricht Dich erreicht, wo immer Du auch gerade bist.

SQL Server Performance, pt I

2008-07-06T23:10:00.000+02:00

If your in Amsterdam, you have to look at windows.

Ok, so my career brought me back to Windows and Microsoft products. Bummer. One of my tasks recently required me to go over SQL Server 2005 Performance guidelines and Troubleshooting techniques and attending a lab of some sort where this performance guru shared some really nice tips.

It was actually very pleasant, and I want to share with you all some of the things I got from the training and if MS SQL Server is your thing, maybe you'll get some value out if this post.

So, first things first:
1 - tempdb: You can read more about it in this Technet article. The default size for this very important db is only 8 MB. Change it according to the few basic rules outlined in the link above.

2- Gathering generic performance statistics. MSSQL Tips gives a very nice overview on how and what kinds of statistics you can gather in MS SQL Server. I find this very useful to start a performance evaluation. Better yet, the Performance Dashboard add-on that can be downloaded here. It's too big and complex for this post, but if you need some pointers, ask me. Another really useful set of tools, jointly referred to as RML Utilities for SQL Server can be found here. Do some read-up on them and enjoy.

3 - I/O. This is one one the key elements in performance for just about any application. This might be a good time to introduce you to the SQL Server Best Practices
. The whitepaper on Predeployment I/O Best Practices is a must read if you don't know the basics on how to measure and improve this performance parameter.

4 - Isolation Levels. Be sure to read the Books Online on the 6 supported isolation levels in SQL Server 2005. Read uncommitted (or nolock), read committed, repeatable read, serializable, read committed snapshot and snapshot. Understand how these different levels affect concurrency.

5 - Stored Procedures. In most situations, SP's will provide better performance over queries any day. The reason for this is two-fold: The Data and Procedure caches, aka Memory Hogs R' us. A nice article I found on this can be read here.

There is so much more to say about this topic that I might consider transforming this in a series of posts. It would be just too much for a single post and there are several areas that I find would be really interesting to go over in depth, provided that I have the time to actually write something that is. :-)

Managing MS SQL Server is much more than pointing and clicking and therefore it is very easy to get it wrong. On the other hand, this is really valuable knowledge if you're considering a career as a performance engineer / consultant. Or even if you're just writing a Web App (RoR springs to mind) that you just can't figure out how to go about squeezing out every last bit of performance of, really knowing what you can do with the database layer is a definite plus.

Talking about the weather

2008-07-02T01:13:00.005+02:00

Hoje foi um dia muito quente. As pessoas andavam meio loucas, a roupa pesada (e a comprida... e em alguns casos a, vá, decente) ficou em casa... E lembrei-me de coisas quentes. O verão em Portugal, por exemplo...

A proposito, a partir de hoje não se pode fumar tabaco em recintos fechados em Amsterdão. Se fôr numa coffee shop pode-se fumar erva, mas sem misturas, claro.

yesterday a fever, tomorrow St. Peter

2008-06-10T22:46:00.005+02:00

Real friends

Beautiful bride

Yet another real friend

Best view of the city

Ou como eu digo, ontem Manique, amanhã Munique.

A proposito, sim estou em pulgas com o iPhone v2.

Lisboa

2008-05-30T12:32:00.003+02:00

Hoje volto a ver a minha amada Lisboa. Ou como diria o Cartman, "Screw you guys, I'm going home!"

O casamento da minha melhor amiga vai-me fazer perder a Amsterdam Tattoo Convention... mas vai ser muito bom voltar a Portugal, mesmo que seja por pouco tempo. Ou se calhar por causa disso mesmo.

Ok, I got an early start

Anjo

2008-05-18T01:01:00.002+02:00

Eu não acredito em milagres. Se acreditasse tinha pedido para Deus te colocar no meu caminho mais cedo.

a month later

2008-05-16T00:37:00.006+02:00

Its hard to believe just how fast a month as gone by.

I arrived in Amsterdam on the 7th of april, so actually it's been a month and a week but I somehow only remember a couple of days so it's a month give or take.

It's been quite the adventure as you will know oh faithful reader. I met some rather interesting people and I was in some weird scenarios sometimes, I was given very much by some, and only the cab drivers have taken more than I was willing to give.

I started working with Blackboard on the 15th and have been helping improve customer support^TM ever since. The feedback we (myself included) have received from our customers recently is amazing. I am proud of being part of such a wonderful group! Go EMEA team!

you can find more of these here

People who know me well, know that I like to laugh about myself and all things surrounding me, this has helped me to deal with some of my adaptation issues. Also, knowing me well means that you're expecting me to bitch about everything that bugs me about my new job. I can't. NDAs and shit like that would probably get me fired.

As a personal experience, working abroad has been just super. It's all about the people you meet and the way you approach situations. I mean, I know so many souls who might be given everything but only notice they should have been making the most out of it when it's taken away from them... That is just stupid! But these guys and gals always have to learn by themselves, so please, be my guest and bang your head as much as you can if the shoe fits.

So, yes, I would definitely recommend moving abroad to just about anyone.

Also, and getting more personal here, I was given the greatest presents ever on my birthday. The one on a little bridge over the Herengracht is the one I will treasure for ever. It's my personal little schatz so I'll keep it just for me for as long as I can... Or sunday. That and the story about my friends playmate girlfriend. We're such lucky bastards aren't we?

As a final note, I'd like to promise all those who used to come here to read my techie ramblings (ok, the one guy) that I'm readying a post on SQL Server Performance, and it should be done soon... so if that's something you're into feel free to come by late next week.

I also have drafts on Netbeans 6, building a Ruby API for tarpipe (which, incidentally I've pitched to some guys here) and JVM tuning. So I haven't totally forgotten that this is a geek blog. I just need some time to get over the city where you can't help but fall in love several times a day.

Decisions

2008-05-14T20:23:00.005+02:00

Must be made. And you only know if you were right when it's done. Yet sometimes life makes it easier on you.

For instance, I was planning on going go to Osdorp's Library event on Portugal and portuguese culture tomorrow. Maybe meet up with some countrymen (and women) and basically see what's up.

But then I got an invitation for dinner at Fifteen. If you don't know Fifteen, than the naked chef hasn't caught up with you yet. It will. It's inevitable.

Well, since it's on the company dow, I really have no choice. If I had it would still be the same, I guess.

Does it make you cry?

A day at D's

2008-05-12T13:00:00.001+02:00

Lazy sunday again.

Since spending such a bright, sunny day at home seemed like a waste of time, I gladly took the opportunity to go over to D's house and hang around for a while. Time passes much faster when your having fun with some friends.

After helping M fixing the wireless on D's laptop (You just knew it, right?) the day started getting much more interesting. Having conversations with other expats is always amazing because you find yourself less alone when others share their experiences and it's not awkward at all to say that you miss what you left behind and that sometimes you are afraid to fail.

So, and because I'm late for a date with some ice-cream in the park, what do you get when you mix a Portuguese guy with :
- A Bosnian-German hotty hostess;
- A Turkish-Bulgarian couple (yes, the undead terrorist and his wife);
- A Bosnian sweet;
- A Swedish-Syrian techie-babe;
- A German neo-teenager;
- A very sunny day;

Don't know? Care to guess?
- Great food and an amazing day;
- Wine and Laughs;
- Sex and the City would be dialogs;
- Work done;
- All of the above, but in reverse order;

Need clues?

Cigarettes, coffee, chilled white wine. Arabic veggie food. Jazz.

Talk, talk, talk. Smiles, laughs and toasts. Stories and hopes. (edit) And no more boobs

Thank you

2008-05-10T16:33:00.005+02:00

Obrigado a todos. Deram-me a melhor prenda de aniversario (das que eu posso falar, pelo menos) de sempre!

Então e agora quando é que vêm cá fazer-me uma visita?

We're actually going to need one of these...

2008-05-08T23:10:00.003+02:00

to my gurdy gurdy friends

Rather lovely thing

2008-05-07T02:40:00.001+02:00

Lately I've found great pleasure in telling little stories about how fun and adventurous my life has been since I've moved to Amsterdam. I usually also put in some pictures illustrating my days and try to serve them up as alternative postcards from my life in this city. Today is no different, just special.

Friday was a quiet day, the city was still recovering from Queen's day and, to break away with the boredom the Postal Service decided to deliver my two really big and important packages to my next door neighbor. This is a thing they do here. If you're not home, your mail packages will get delivered to the next door. You have to explicitly opt out of this behavior if you want to avoid meeting people in this sort of circumstances.

You don't see it, but inside these heaven stood. To be more precise, a Nespresso machine and my beloved Tango

The highlights of saturday include me finding that there will be a Portuguese day at Osdorp's own library. It's funny how little things can catch you off guard like this. Other little things that can catch you like this are love, poppers and bitterness. But I don't want to talk about neither.

Had it been Turkey, and I would not have been surprised. I mean, this is Osdorp! (read in a spartan way)

On sunday I went to Van Gogh's museum, and I must admit I had some mixed feelings about it. I fell in love with Millais. And I was totally amazed by the quality of the Photo exhibit Me, Ophelia. I had no idea of whom Millais was, but seeing his masterpiece, Ophelia, took me places. I saw Nick Cave planting a rose in Kylie's mouth, I understood PJ Harvey's "To bring you my love" artwork and I found Van Gogh to be a total bore in comparison.

Taken from flicker's John Everett Millais group. Photo by Frank Van Eykelen

Sunday was both mother's day and my birthday so I had plenty of reasons to feel down but I didn't. I had the most perfect day I could ask for, and I wouldn't take the time to have sangria in the park if Lou asked me himself.

All day I kept remembering that I was once told by an old lady that all I can cherish in life are the moments I have with my friends and the people I love because nothing I could ever buy will stay with me when I close my eyes. She never saw an iPhone, that's for sure, but I couldn't stop thinking just how right she was.

"if I show you the roses will you follow?"

So finally, here are some Sam Taylor-Wood's, to wrap your mind around something nice before you go to sleep.

Self Portrait Suspended I

Bram Stoker's chair

Ophelia, the soap pt. I

2008-05-06T03:23:00.006+02:00

While sitting at the smallest pub in town at any given night, you can expect to witness all sorts of crazy things happen. I mean, Louis is a guy who has a letter from the British Government apologizing for the behavior of some blokes hanging proud in his wall.

Today I met a rather interesting character, I'll call her Ophelia. As I went in, she sat quietly at the end of the bar sipping her drink and relaxing from a likely hard weekend.

I had promised to make caipirinhas for the staff there, so I was rushed behind the counter pretty much has I laid my bag down. I made my best to batter, mix and pour the drinks and she started looking, first sideways then just glaring lustfully at the sugar and lime half filled glasses.

I had just finished making my second glass when she went ahead and invited herself to be customer number three. She looked straight at me and said
"If the loveliest bartender in town would be so kind ...". Thick londoner accent, ginger lips and graceful gesture included for free.
Annie slid the caipira she was holding and stared at Ophelia who took the glass and caressed the straws for a second. Not being the most graceful of dutch girls, Annie transpires raw sexuality and always seems like she knows what she's doing. Andrew on the other hand, an atypical english charmer with an eye for fun and a hand for game, leaned back and enjoyed his own toughs for a while.

I made quick toast to airport security guards who seem afraid to loose their jobs when someone else is doing a better job at body checking (which, incidentally no one got so I was the only one laughing) and the four of us moved a bit closer so we could chat. Ophelia didn't seem bothered by the attention she was getting from what I could tell, although I was busy choosing what songs would play nice with my mood for the night. Morrissey, Oasis, Depeche and just a little Nina Simone would do the trick.

the origami is like my signature

An uncomfortable silence filled our little corner table when Annie asked what Ophelia did for a living. Calmly, she inhaled, put her glass down and said without even a touch of irony in her voice: "I'm a high-class prostitute." then added "On holiday!"
I laughed my head of, Annie was shocked and Andrew's eyes went wide as his hands reached for the girl's long, fit legs. He uttered "Are you for real?"
"Andy, put your wallet down, she's just telling us to buzzer off, and she's got a great sense of humor by the way" I said.
"No. If I was telling you off, I'd say something like : Yes your wife doesn't understand you, your mistress looks like your mother but you'll still have to pay if you want to keep looking at me" Said her.

I drank some more, tried hard to remember why I was in a pub to begin with and left this unlikely trio to them selfs for a bit. I went for some cigarets and fresh air. I really did, so I can't tell you what the conversation went like. When I got back there where hands, legs, cleavages and a whole lot of old dirty bastards staring at the corner table. Nothing too shameful, although the elephant in the room had little space to breath, but hey, this is amsterdam. Sex is not a tabu.

I tried to reach for my bag so I could leave, but Ophelia grabbed me, and not by the arm, and shouted "This is all your fault you know? So don't even think about leaving before me". I sat. Lit another cigie and listened to some connoisseur comments about size, width and leverage. Then about breasts, tongues and asses. The charming english man did his best to entertain the notion that he could go home with both the girls, Annie couldn't get her hands off the delightful stranger, who on the other hand seemed ever more comfortable as she steered the conversation to familiar territories.

What happened next stays where and with whom it happened. I went home alone.

"with love (signature)" alcoholics are never boring

28

2008-05-04T23:19:00.003+02:00

Today was the warmest, most beautiful day in Amsterdam this year. Incidentally it was my birthday too.

Friends, expressos, strawberry pancakes, martinis, pizzas and the Van Gogh museum. Mix it, and you got the perfect recipe for an amazing day.

More details to follow, just as soon as I get my rest.

Queen's day (and night)

2008-04-30T20:29:00.010+02:00

30 de Abril marca o "aniversário" da rainha Beatrix e os holandeses prestam-lhe homenagem durante 24 horas.
Vamos por pontos:
1 - Beatrix Oranje-Nassau nasceu a 31 de Janeiro de 1938;
2- Foi coroada rainha a 30 de Abril de 1980;
3 - Os holandeses não são bons com datas. Não, a serio. Morgen quer dizer (esta) manhã, mas noutro contexto quer dizer amanhã. Isto pode causar duvidas em qualquer um;

Então, por aqui celebra-se andando pelas ruas estreitas, que nem sardinhas enlatadas, assite-se a qualquer um dos varios concertos ao ar livre que ocupam todas as principais ruas e praças, bebe-se (duhh) fuma-se (double duhh) e dança-se toda a especie de ritmos. Ah! e toda a gente veste qualquer coisa laranja. Por todo o lado encontram-se pessoas a vender artigos de todos os tipos e categorias no que constitui muito provavelmente a maior feira da ladra do mundo.

No que me diz respeito, foi mais uma oportunidade de sair com o pessoal, rir e conhecer pessoas. O dia de hoje ficou marcado pela Eriko, uma simpatica hospedeira de voo japonesa que quer ajudar outras mulheres a envelhecer com estilo e graça (um dia explico). O Michael e as suas duas amigas e o party-man Ron também merecem destaque porque fartei-me de gozar com eles e ainda me pagaram uns Cosmos (os meus primeiros). Eu admito, começo a gostar de americanos!

Mais uma rodada de fotos para celebrar o dia da boa rainha?

Cosmo! A better way to get drunk!

O meu colega Andy e a Eriko. Mais tarde houve um esforço concertado de tentar melhorar as relações nipo-britânicas

Juro que não fui eu que escrevi isto!

Feira em Osdoor

A chegar a Leidseplein. A partir daqui não consegui tirar as mãos dos bolsos, quanto mais fotografias!

Busty babes!

Big babes! E o Ron com o seu optimismo americano foi meter conversa....

Boat party! Next time man, next time...

Pequeno palco com Djs

Trippin' all the way to the beach

2008-04-27T22:40:00.001+02:00

Então hoje fui a praia. Supreendidos? Eu fiquei. Vivi grande parte da minha vida ao lado da praia e raramente lá fui. Alias o meu bronzeado neoblanc era bastante popular por alturas do verão.

Segafredo! Café expresso! yey! A proposito, sabem o que quer dizer sega fredo em italiano? Não? Se pedirem...

Mas aqui é diferente, aqui fiquei em pulgas de saber que havia uma praia razoavelmente perto, a 30 km. Zandvoort aan Zee. Para quem não sabe holandês (tipo eu...) é qualquer coisa como "areia para o mar". Nada como um nome descritivo para uma localidade hein? Descubro a cada dia que passa que o holandês deve ser das linguas mais feias do mundo. Se imaginarem um inglês bêbado a falar alemão de marinheiro e estarão lá perto.

Parece uma mistura da Figueira da Foz com a Praia Grande, mas sem ondas e o mar... bem é o Mar do Norte.

Como podem ver a praia estava longe de estar cheia, até porque o ceu estava cinzentão, mas soprou uma brisa quente a tarde toda que apenas acentuou o obstrusivo cheiro a peixe frito que emanava das barraquinhas de petiscos. A serio, esta gente tem uns habitos alimentares estranhos.. Peixe frito na praia?? Ok, há pior... Podiam vir para a praia rominar umas cenouras...

Esta simpatica menina estava a ruminar cenouras cruas. Lamentavelmente só a apanhei de costas, mas podem acreditar no que eu vos digo

Ainda cheguei a tocar na areia, mas como me pareceu um pouco desagradável ao toque e estava algo fria, voltei atrás na minha intenção de arriscar apanhar hipotermia nas mãos.

E assim, até porque é um dos meus maiores prazeres, decidi parar num bar aleatório e apreciar o fim de tarde com um martini a fazer-me companhia.

Martini, blijvend in mijn gedachten :-)

Como nota final diria que esta praia não será nunca uma atração turistica para A'dam. No entanto, se se virem numa situação em que as saudades de uma cerveja á beira mar bateram forte, ou se tiverem que ficar por aqui muito tempo.. vale a pena. É bem melhor que nada.

Ah, o cheiro a peixe frito deixa de enjoar ao fim de algum tempo... dizem-me de Inglaterra.

Sunday starts with a smile

2008-04-27T08:27:00.005+02:00

Ok, quickie, did you tough that NIN's latest single had a Meathead <-> disco dancing vibe to it? -Well, they seem to agree. Trent posted this wonderful fan art and called it the official video!

Enjoy you guys. I'm going to the beach. (more on this later)

Idiocracy

2008-04-26T09:37:00.003+02:00

Quem me conhece sabe que politica é um dos meus temas favoritos, porém abstenho-me tanto quanto possivel de falar desse assunto neste meu cantinho no blogger plantado.

Hoje, vou abrir meia excepção. Vou falar do conceito por trás de um filme de 2006, o Idiocracy porque de vez em quando sou recordado que a vida imita a arte como a arte imita a vida.

Então imaginem o seguinte. Uma familia de classe média, com os estudos e as carreiras ocupam o seu tempo e por vezes demoram 3 a 5 anos para ter o primeiro filho. As prioridades passam por conseguir estabilidade financeira e vá, uma carreira, antes de ter um filho. Mais tarde na relação poderá aparecer um segundo filho, mas é cada vez mais raro. Estamos perante uma falha por detrás da lógica de Fibonacci. A proxima geração pode de facto ser em numero inferior á anterior.

Já uma familia de um estrato sócio-economico baixo, geralmente começa por ter filhos ainda na adolescência e, em paises pseudo-socialistas como os EUA e Inglaterra ou até Portugal são compensados por isso. Dá-se o caso de muitas familias deste estrato terem 6 ou mais filhos ao longo da sua vida.

Dizem-me que em Inglaterra é considerada uma opção de carreira sair da escola e ter filhos, porque o estado dá uma casa, dinheiro e até um carro pelo seu "incómodo". Consequências?
- Vivem á conta das familias que trabalham e descontam;
- Abandonam por completo os estudos, e criam um ambiente familiar propicio para que os seus filhos também não ambicionem seguir com os seus estudos.
- Volto a repetir, têm pelo menos o triplo dos filhos de um casal médio no mesmo país;
- Já vos falei de Fibonacci?

Estatisticamente penso estar mais que comprovada a ligação entre o QI de um individuo e não só os genes como também o ambiente em que este é educado.

Voltando ao filme. A continuar por este ritmo dentro de 5 ou 6 gerações o mundo vai estar dominado por gente sem estudos, sem cultura e possivelmente um qualquer "average joe" que fosse congelado agora poderia facilmente ser a pessoa mais inteligente á face da terra nessa altura. Ridiculo?

Então pensem no seguinte, porque foi assim que eu comecei este post:
- Em tempos Portugal foi um país de aventureiros de verdadeiros "go getters", mas, como diz um amigo meu brasileiro, "todos os bons emigrararm. Ficaram só os que eram demasiado burros ou medrosos para sair".
- Muito antes de sermos a costa oeste da Europa, fomos uma região de Espanha. Mas houve brio e engenho, a identidade nacional veio ao de cima e retomámos a nossa independência.
- Noutros tempos, um punhado de homens cansou-se de um regime ditatorial que lhes sufocava as esperanças de virem a ser algo mais, que os empurrava para uma guerra sem sentido e fez uma recolução. Foi em 25 de Abril de 1974.
- Hoje temos algumas pessoas que se supõe pertencerem a uma especie de elite cultural e cientifica a proclamar um regresso a uma politica fascista ou, pior na minha humilde opinião, a desconsiderar as datas da Implementação da Republica, ou o Dia da Revolução, e o significado que elas têm em quem nós somos enquanto nação.

Meus caros, um povo sem história nem memória é um povo sem futuro.

Yes, but what difference does it make?

2008-04-21T01:38:00.005+02:00

Listening to:

The Smiths - The World Won't Listen ->You just haven't earned it yet baby

100th post. with pics

2008-04-19T18:55:00.000+02:00

Since joining my new work here in Amsterdam I've been trough some amazing stuff. This is my life in the last week. In pictures because I'm tired and slightly drunk.

Some of the guys at work. In this case the sweeds.

What to do here before you die, money allows... that is

The smallest pub in town. not so bad.. Going to the bathroom, now there's a challenge for any wannabe climber!

I know a'dam is a fucking playground.. but this is ridiculous. A ferris wheel and other amusements in the center of the square!

Damn!!

2008-04-16T20:05:00.004+02:00

So I finally get around to going to Teasers, at a couple of colleagues invite, and when I get here, all I get is beer! It seems the Dutch government banned the bodyshots and topless serving there. Too bad. The girls ain't what hulf promised (am I getting you in trouble know luv ?) , but at least I got this one to smile and dance for me. And pose for a lousy photo.

Coco is a dancer, (this sounds like a song title...) and a waitress. She's also very nice and cheerful. So it was worth the 6 euros. (the beer god damn it, what else would I've meant?)

On a side note, today I found two dutch kids (in their late teens) who speak portuguese. I wish I went to school in a country where you can learn just about any language you want.

Für mein schatz

2008-04-15T23:44:00.003+02:00

lös mich auf wie zucker
wenn du die zeit dafür findest
machs sanft und plötzlich
im handstreich
oder einfach nur mit einem blick
es war alles schon mal da
machs am besten noch während ich tanze
ich tanze
ich tanze
du atmest wie ein funke, ohne körper mitten in mir
sehnsucht ist die einzige energie

Eintürzende Neubauten - Von Wegen (Alles Wieder Offen)

PersonalDNA Score

2008-04-13T21:50:00.005+02:00

Lay sunday, oh lazy sunday..

Well, to cheer me up on a lazy sunday nothing better than a personality test. This one I got compliment's of Restelo, a portuguese blogger who also relocated recently and whose blog I'm a devoted follower (Oh, her blog is in Portuguese, so....)

So, as I was saying, this test, PersonalDNA was actually one of the funniest I tried so far, and attributing me a result like "Generous Leader" how can it be wrong? Yes, "Glorious Leader" would be a stretch...

Unfortunatly, it only gives you a little badge as a reward, but I took a snapshot of the full personality trait chart, so here it is:

The return of the Undead Terrorist (and his wife) and how my first week ended in red

2008-04-13T01:25:00.001+02:00

Para acabar a semana, e porque já tenho a mobilia montada e portanto estou a sofrer de uma depressão pós-saida-da-linha-de-montagem cá vai o ultimo post sobre a minha mudança para Amsterdão.

Então, ontem á noite aparece-me a porta o clã Hussein para se darem a conhecer e prontinhos para me ajudar. Lá houve mais um susto, sim porque eu não estou habituado a receber visitas de apelidos tão ilustres! Mas desta vez passou logo que o pequeno Undead Terrorist saltou para cima da mesa (que eu ainda mal tinha apertado os ultimos parafusos...) e começou a dar luz á minha nova sala. (Se um dia eu lhe conseguir tirar uma foto ás escondidas, percebem o porque da alcunha. Porque não tirar uma foto á descarada? Porque ai eu ia deixar de ter duvidas sobre se o UT é capaz de matar ou não!)

Pormenor interessante e vá.. intrigante. Como é que um tuga que fala em inglês o dia todo se entende com um bulgaro-turco a viver na Holanda? Em alemão, claro! E muita linguagem gestual.

Fast-forward para hoje á tarde. A mobilia está montada, a casa e a loiça limpas, luz em todas as divisões. Decido oferecer-me uma prenda e vou comer batatas fritas com maionese para a Dam Square. Dou umas voltas, evito as ruas que já conheço e meto-me no Red Light sem me aperceber. Primeiro sinal, os ingleses histéricos, seguidos dos passadores e por fim as luzes. As cortinas estavam quase todas fechadas, o que quer dizer que havia muita gente mais divertida do que eu. Em numero igual estavam outras a trabalhar no duro. Volto para casa porque nunca gostei particularmente de olhar para as montras de um talho.

Para fechar, umas fotos da minha primeira semana aqui. A qualidade é terrivel, e fica aqui a nota. Aceitam-se donativos para a compra de telémovel de ultima geração.

Ah, estas duas ultimas fotos têm dedicatoria. A da direita vai com um abraço para o cromo lampião que me fazia companhia na Caixa e a da esquerda, com um grande beijinho de Gute Besserung, para uma leitora especial deste berloque. Já sabes que se quiseres andar... Isto aqui é sempre a direito! :o)

Going with the flow

2008-04-12T21:54:00.004+02:00

Lately my collages at prt.sc have been printing their terminal usage history. I found mine to be interesting, so I'll post it too.

BlackBookII:~ jpa$ history | awk '{print $2}' | sort | uniq -c | sort -rn | head
59 ruby
59 clear
51 dscacheutil
37 ls
35 java
35 cd
31 sudo
24 vi
20 ps
19 rm

Yeah, I like to clear the output before doing something else... The dscacheutil honorable mention is a memory from my home in Portugal, see, the problems I had with Meo vs Leopard never quite disappeared and doing a "dscacheutil -flushcache" was the only way to get over the nagging network resolution bug.

Super-Master-Ikea-Ninja

2008-04-12T01:09:00.004+02:00

É assim que me sinto hoje.

Ontem fui ao Ikea cá do sitio,fazer a minha certificação super master customer, que é como quem diz, mobilar a segunda casa em menos de 6 meses. Nada de especial, só é preciso apanhar um metro (aqui a definição de metro é diferente. É um comboio da zona metropolitana, tem estações subterrâneas mas a maioria é de superficie) de Lalylaan para Bullewijk e mais 6 minutos a pé. Para memoria futura, Lalylan para mim é ladyland e Bullewijk é bolchevique. Fica dito.

Bem chegado lá, sou confrontado com uma certa alegria por o catalogo ser quase igual ao de Portugal, o que quer dizer que não tenho dificuldade em encontrar o que procuro. Isto porque as imagens enganam, certo? errr ok. De resto há uma certa familiaridade que já estabeleci com a marca. Aqui por exemplo, em vez de ir ao Continente, vou ao Albert Heijn, em vez de ir ao BES vou ao ABN mas compras é mesmo no Ikea. Dizem que é uma questão geracional.

600 euros depois já tenho um sofá cama, uma mesa e cadeiras, um armário, coisas de cozinha e para a casa, o minimo dos minimos para um touro, diria eu. Que isto do amor e uma cabana pode ser verdade, mas não tenho ca o amor, e a cabana precisa de uns arranjos.

Bom, a entrega do material foi feita, 22h00 em ponto, As duas figuras suspeitas, ao melhor nível de um HP Lovecraft clássico. Passado o susto, e porque queria a mobilia mesmo muito, lá abri a porta. Pessoal simpatico estes turcos. Para terem uma ideia, fiquei com a entrega feita e ainda consegui que um deles, o Hussein (daqui para a frente, the Undead Terrorist) ficasse de me ajudar a montar as coisas, arranjar a iluminação e a mulher dele passou a ser a minha mulher a dias. Nada mau, hein??

Aqui temos a foto uma turca num concerto do Ozzie Osbourne. Acho eu...

The kindness of strangers

2008-04-09T21:18:00.003+02:00

Ora, seguindo com os posts sobre a minha realocação cá vão as historias do dia de ontem.

Ia a caminho do gabinete de imigração, no tram 2, e decido perguntar á moça ao meu lado onde devo sair (fica aqui a nota: a saida mais perto do GBA é na Heineken Brewery, mas sem parar para ver a exposição, ok?) . Ela responde-me num pidgin english que me pareceu jamaicano, mas nunca fiando "cume wid me man, I go there too". Conclusão do dia: Ao abordar um estranho em Amsterdão, as hipoteses de:
- este falar inglês :99%
- este ser estrangeiro : 60%
- este ser uma esta : 75%

E pronto, lá fui eu tratar de mais burocracia. Despachado que estava ao fim de 5 minutos, até porque tinha de marcar uma reunião por telefone antes de ir á migra cá do burgo e não o tinha feito, so... no deal. OK, sem problemas, ainda deu para ir ao ABN-AMRO abrir uma conta. News flash: os bancos aqui fazem de tudo para agarrar clientes. Parecem as financeiras de esquina ai em PT. Resultado, abro uma conta sem pagar um centimo. O que vem mesmo a calhar, porque é mais ou menos todo o dinheiro que tenho.

A caminho do banco, e sem grande aviso o ceu deixa de ser tão azul, o sol esconde-se por trás de umas nuvens negras e começa a chover. Granizo. Eu fui apanhado de surpresa, mas não tanto como um ciclista passou por mim a segurar um bebé ao colo. Gente estranha... até me deu arrepios. Já vos falei da minha teoria entre o uso de bicicleta e o consumo de drogas?

Bom, refugio-me dentro de uma tabacaria com um outro transeunde. Um velho daqueles que ainda se deve lembrar da II Guerra Mundial. Queixo-me da chuva e ele não esta com meias medidas... pede-me para esperar um pouco que ele vai a casa buscar um chapeu de chuva para mim! E foi mesmo, á chuva... ao frio... fiquei sem palavras para lhe agradecer e sem 2 euros que tinha no bolso e que insisti em dar-lhe pelo chapeu.

Claro que nem tudo podia ter corrido bem... o chapeu é azul e branco, cores que não me alegram o coração de maneira nenhuma. Nem no estrangeiro!

É oficial. Sou um emigrante

2008-04-08T11:32:00.005+02:00

Não trouxe a mala de cartão, mas já tenho algumas historias para contar.

1- Os taxistas são todos iguais. No mundo inteiro! Ontem á noite estava demasiado cansado para me chatear. Mas fica o aviso: There be pirates!
2- O hotel (e toda a zona circundante) onde fiquei, parece ter sido transplantado do norte de Marrocos, o Ibrahim, o Ali e o Mohamed foram os primeiros holandeses com quem falei hoje. Fixe.
3- Tratar do Sofi number é facil. Demorou 15 minutos incluindo espera, fotocopias e converseta da treta com a simpatica menina da repartição.

Bem, tenho de ir ao escritorio. Deixo-vos uma imagem da rua que tenho de passar para lá chegar

1000.times better

2008-03-19T01:37:00.003+01:00

Short code post. Just the story of how do you get someone looking into Ruby when they had already dismissed it as a fad. You know, the hype can blind you.

So the situation arrived when a friend needed to have a particular chunk of XML repeated 1000 times. No more, no less. Sounds stupid but it's just an oversimplified anecdote.

When he asked me for a quick script to do it for him, I saw an opportunity to show how Ruby would be a good tool for this job (insert promo here). Being a "show, don't tell" kind of guy, this was the code I presented him.

def thousand_repeater(string, repeats =1000)
repeats.times do
print "#{string}\n"
end
end

Not too fancy by any means. You just have to call it with the string you want, optionally provide the number of times you want it repeated and that's pretty much it.

Ex.: thousand_repeater "hello",3

The thing that got to him was actually the ability that Ruby gives you of doing something like "1000.times", compared to the more familiar (at least for him)

for(i=1; i<1000; i++)

Thats it.

it's official now, so I might just as well shout it out loud!

2008-03-10T16:16:00.003+01:00

Que roubo....

2008-03-07T19:02:00.004+01:00

Então um gajo em Munique paga 3,60 Eur por 17 cigarros??? Onde é que estão os meus outros 3? Perderam-se???

Esta foi uma semana louca em que conheci mais aeroportos do que em todo o resto da minha vida! Zurique, Amsterdão... Munique. Parece um tour pela Europa civilizada, eu sei. Mas tudo faz sentido. Amanhã conto.

Quando queremos voar mais alto nada melhor que dar um pulo de um sitio muito alto. Ou então correr por uma planicie a perder de vista, qual pista de aeroporto...

;o)

Jantar de Homenagem ao Professor Roberto Barbosa (IADE)

2008-03-06T17:04:00.004+01:00

A Kay está a organizar um jantar na "Dona Elisa" em Santos em jeito de homenagem ao Prof. Roberto. Não são bem vindos choramingas nem urbano-depressivos. Os jantares do Rob sempre foram uma festa. Let's keep it that way.

foto da autoria de Roberto Barbosa

Confirmações para estacaoabstracta@yahoo.com.

Obrigado.

O Meo é maior que o teu (1).

2008-01-22T04:27:00.000+01:00

A boa noticia é que, após quatro meses, já tenho TV e Net e Telefone. Mais propriamente adquiri o serviço Meo, o triple play da moda. Obrigado á CML e a PT por terem unido esforços e tirado o prédio onde moro da idade das trevas.

A oferta prometia, até porque as medições indicam que disponho dos 16 Mb de ligação, que seria o valor recomendado, mas na verdade apresenta algumas falhas. Nem todas elas relacionadas com o débito de rede. Não nos devemos esquecer que se trata de um produto algo novo no mercado e talvez daqui a uns tempos a qualidade melhore. Só podemos esperar.

Decidi fazer a minha própria critica ao produto uma vez que parece quase impossivel encontrar informação isenta e com algum espirito critico sobre o Meo, a menos que contem com um post ocasional de um empregado do Sapo, ou aquele flog do "omeumeo" que parece ter sido inventado pelo mesmo tipo do segredo vodafone, porque me parece algo..hummm fake. As minhas desculpas se de facto houver um blogger anónimo que avisa a "malta" para problemas com a facturação.

Para dourar a pilula incluo também alguns comentários sobre a qualidade do "networking stack" do Leopard porque dizem que um mal nunca vem só ;o)

- A oferta de canais disponiveis no serviço 30+10 (penso que é o base) é virtualmente igual aos de todos os outros operadores no mercado. Incluido no pacote vem, no entanto, um canal em HD sem qualquer programação de interesse mas que ainda assim vale a pena ver pela qualidade da imagem. Isto, claro, se tiverem uma TV com capacidade para tal.

- A qualidade do router é simpatica. Aparentemente o Leopard é que não gosta muito do wireless porque quando abro o Mail e o Safari em simultâneo, regra geral, perco a ligação. E a imagem da TV. Aborrecidito no minimo.

Pior mesmo é que qualquer site que eu tenha tentado visitar aquando do erro deixa de ficar acessivél, pois mesmo após reabrir o Safari, ou abrir um browser diferente, ou mesmo re-iniciar a maquina (old habits) continuo a receber uma página de "Resolution Successful"...Nota mental: Redefinir o conceito de "Success".

Para resolver a situação é preciso fazer uma limpeza ao cache do felino mais tosco da familia. Já agora, e antes que perguntem.... dscacheutil -flushcache

- Por defeito, ou seja, quando o técnico instalador sai da casa do cliente, a rede wireless faz broadcast do SSID apesar de contar apenas com WEP como medida de segurança. Para alterar estes "pormenores" basta abrir um browser, depois de autenticado na rede, e ir a http:\\home .Ou então http://ip-do-router/xslt?PAGE=J46&THISPAGE=J01&NEXTPAGE=J46 se gostarem de ver mais opções no menu. :o)

- A box com o disco rigido é barulhenta até quando está em stand-by o que me parece estranho, mas segundo o suporte técnico é assim mesmo. A segunda box já não é tão barulhenta, mas também não tem um disco lá dentro, não é?

- A funcionalidade de agendar a gravação de conteudos é desaproveitada porque, como se sabe, raramente a programação dos canais é mantida, pelo que o mais normal será perderem uns minutos do programa. De resto é algo inovador. Se bem que parece que me lembro de em tempos ter havido uns leitores de vhs que também faziam isso.

- A possibilidade de ver os incorrigiveis directa e gratuitamente na TV. Adorei! Parabéns! Se a resolução pudesse ser um pouco melhor ficava perfeito.

- O Video On Demand, apesar de me parecer uma boa ideia ainda não experimentei. Mas gostei de ver a possibilidade de alugar conteudos para adulto. Poderá evitar alguns constrangimentos aos mais timidos... ou "torrent impaired".

Adicionalmente, o Meo oferece um filme por mês para atrair os clientes a este serviço tipo videoclube. Mas, para já, a oferta pareceu-me fraca. Será uma questão de mentalidade, mas não vou experimentar um serviço (mesmo gratuito) se a oferta não me apela minimamente. Quem pensou esta estratégia de marketing espera, certamente, apelar á palavra mais querida do português médio (Grátis) não receando uma certa conotação com a má qualidade do conteudo disponibilizado.

Quanto a limitações técnicas incompreensiveis, até agora, só encontrei duas:
- Desbloquear conteudos para adultos de forma definitiva. Não dá.
Se estiverem a ver o Family Guy e a Megan (Ils son fous ces americains) decidir ter sexo na orelha para preservar a virgindade até ao casamento vão ter de imaginar a cena... a menos que tenham o comando á mão e se lembrem do código de desbloqueio. E mesmo que procedam ao desbloqueio, mas mudem de canal, terão de passar pelo mesmo noutra ocasião em que desejem ver conteudos igualmente chocantes.

Ah... se meter sangue e tripas por todo o lado não há problema. Sexo é que não. Mas isso são contas de outro rosario...

- Durante a gravação de um programa, a segunda box tem de estar sintonizada no canal que está a ser gravado. Esquisito. A box principal deveria poder tratar disso sozinha, não? Será o Windows CE a fazer essa gestão?
Mas giro mesmo é ver a mensagem de aviso que o software apresenta. Lamentavélmente não tenho um screen shot á mão, mas assim que tiver faço o update a este post. Se lerem o aviso ficam mais confusos do que se não o lerem e carregarem na opção que permite continuar a ver o canal...

Tirando isso, e como diriam os Garotos Podres, tudo bem.

1-Ok, este deve ser o pior titulo de um post de todos os tempos. Mas hei, fica como uma homenagem á MyBrand (aqueles do Allgarve e do logo da EDP que diziam ter sido roubado de algum lado) que fizeram aqui um optimo trabalho.

Forget OLPC. OSPC is more like it!

2008-01-13T01:22:00.000+01:00

Need help explaining your children why there is a server in the house?

This will help.

What else?

2007-12-25T13:10:00.000+01:00

Thanks mom!!

Krav Maga

2007-12-21T04:05:00.000+01:00

At the last Prt.sc dinner I was talking about how cool Krav Maga was and how I thought everyone should learn it when I realized that only Andreia knew what the hell I was talking about.

Well, Krav Maga is a personal defense system which originated from Israeli self defense technics and was developed by Imi Lichtenfeld during World War II. The name in hebrew means Combat (Krav) Contact (Maga) which pretty much sums up what's it's objective is... Close, or contact, combat.

Despite it's origin, or maybe because of it, this method now serves as combat training for major armed forces (the SEALS are a notable example) as well as police forces around the world.

If you're in Portugal, you can go to the Portuguese Krav Maga Federation site, or follow this blog to know more about this self defense technique and were you can learn it (by the way, I highly recommend you trying to catch a Paulo Pereira's class). If you're not, and most *my* visitors tend not to be, well try googling for your local Federation or start here.

Here is a little demo Richard Douieb gave at Bercy's International Martial Arts Festival in 2003. Enjoy.

P.S : kudos go out to eduardo, who at 8, is the best student I ever had.

Yet another Mail.app bug

2007-12-19T10:22:00.000+01:00

I don't like to repeat myself too much, but it seems that Leopards Mail.app fails at math.

Unless of course 4294967294 is the new zero.

Wanna buy Microsoft for 1 Million Dollars?

2007-12-18T17:16:00.000+01:00

Yes you can! And you know you want to!

But be sure to read this first.

News of the world

2007-12-07T21:45:00.000+01:00

What an exciting week this has been!

We started of with a native Mono release for OS X, which you can read more about at Miguel's blog.

Then it was Netbeans 6, which is IMHO the best IDE for Ruby and Rails development and it's yours for free. Here.

And today we can rejoice at the launch of Rails 2.0.

Hurray for us!

On a side-note, I just wanted to share with you a conversation I had with a mono hacker regarding the look of Mono on Mac OS X, even if in a somewhat twisted way for better reading :

Me > People are complaining it doesn't look "native".
She > Well, there are two answers for that:
Novell is currently concentrating on making Mono on the Mac a stable development platform. The System.Windows.Forms layer has support for theming and we could accept contributions for a Quartz theme that uses the HIToolbox APIs. Or, in a shorter version, we accept patches.

And then she said goodbye with the funniest tagline I've heard this week :"nothing like a linux forum to complain about how a windows technology looks on a mac"

Leopard Tech Talks

2007-12-05T11:43:00.000+01:00

Last monday we've had the first Leopard Tech Talk in Lisbon, but much to my regret I didn't made it.

That's not at all unexpected since I'm having so many "shitty work days (tm)" but what's surprising me the most is that even with such a loyal and committed Mac fan base here, I haven't read a single post or e-mail about it.

Did anyone go? What was it like?

f*ck it!

2007-11-30T13:49:00.000+01:00

NIN's remix site is up.

Downloading 15+ years of remixes a registration away!

5 Favorite Movies? Hum... You bet!

2007-11-29T01:40:00.000+01:00

I've been seeing a couple of bloggers posting about their favourite movies of all time, and I felt like doing my own "best of" list. The principle is easy: name your 5 favorite films of all time, say something about them and if possible link to their official site or something.
I've also added a couple more rules: Wait until every other blogger in the world have done their own list; Try not to judge their intellect on how bad their choices generally where.

So, having said this, here it goes but in no special order:

* Animatrix
The whole series. All 9 episodes. Loved them and I honestly think it was the best thing coming out from the matrix.

* Fight Club
Pure genious. The book is great, but Edward Norton and Brad Pitt together are better. Let anarchy rule!

* Ghost In The Shell
This one actually changed my life. Very seminal. And the artwork is so inspiring.

*American History X
Again Edward Norton with a great role as a repenting skinhead. Both entertaining and touching. The scene that shows Edward's character grinning as he gets arrested after murdering a man is so scary it definitely makes up for the predictable finale.

* Natural Born Killers
This is how a legend is born. Although Tarantino didn't direct this film, it was is big success as he was the writer. Best Soundtrack ever, courtesy of Mr. Reznor.

* Trainspotting
Here I must concede that the movie lacks in comparison to the book. Still a great movie with a message that changed my mind about what I wanted out of life.
"Choose life. Choose a job. Choose a career. Choose a family. Choose a fucking big television". Check, check, check and... check.

* Deconstructing Harry
Definitely one of Master Allen's masterworks. If you don't laugh trough it, you may be brain-dead and not realize it.

*Brother
Takeshi Kitano, or Beat Kitano as he referes to himself writes, plays and is the meanest yakuza in the world. Ever.

A movie with substance

2007-11-28T02:17:00.000+01:00

Every so often I get to see a film that touches me.

It happened recently with shortbus which made me laugh hysterically and this weekend again with Control, a film by the photographer Anton Corbijn.

Corbijn's previous experience with a camera was best known as a music video clip director, with some great bands like Depeche Mode and Red Hot Chili Peppers (Give it away know!) unless that is, you happened to catch his short film "Some YoYo Stuff", about one of Reznor's favorite artists, Captain Beefheart.

I could go on and on about how much Joy Division meant for me or how I and Glen Matlock both got expelled from would-be great bands for dancing to a different beat, but that ain't too much to the point.

The film in it self is heart touching as it tries to properly tell the story of Ian Curtis' Division rise and early demise, and as it would be expected from Corbijn's previous body of work, how the photography is amazing. That isn't my point either.

My point is this: If you have a heart go see this movie and feel it being touched from a distance by a genius.

out on safari and back again

2007-11-22T23:05:00.000+01:00

And some people still ask me why I like Firefox better... You know, 75% of my visitors use Firefox. So should the rest of you.

prémios codebits (edit III)

2007-11-15T20:05:00.000+01:00

Prémio mais votado pelo publico
sapo frogger - Pedro Cardoso
(com as minhas desculpas pelo erro.)

Prémio Ideias
bookworms - Pedro Sousa

Prémio Remix
sapo boavida - Luis Rei e Samuel Martins

Prémio Geek
Bruno Pedro

ei esta malta é (quase) toda do Prt.Sc !!!!!

Parabéns a todos!

...e o resto já não ouvi. Já só tinha ouvidos para os Wraygunn !

Half backed apple

2007-11-15T11:40:00.001+01:00

Ok, so the portuguese version of Apple Store is up, some might say not a minute too soon, but not me.

I mean, either Apple entered the Web 2.0 bandwagon of "release soon, release often" or someone should get their ass kicked. What the hell is up with this 3 language web page?

Do you speek Spanporglish? I didn't bother looking any further. That was quite enough for me.

An ice cream that creamed a car

2007-11-13T21:54:00.000+01:00

This is a somewhat old story that I've read some time ago. It came up today in a conversation I was having with some co-screenies.

I had to do some googling, but was able to find a good enough recount of the story. Read it here.

toad codebits day 1 - random thoughts

2007-11-13T21:24:00.000+01:00

Well, in and out of the first day of Sapo Codebits, or Toad, and a few thoughts sprung to mind.

I'm gonna do this the old school way of dividing in a The Good, The Bad, The Ugly sort of way, so..

The Good :
- Getting to know fellas like Diogo, Luis, the segway dude, Samuel and the lovely Mono Hacker, and meeting up with "the" PHP Man , the Python Evangelist Extraordinaire, Franc and the hacker behind some of the funniest storys I've heard and of course, the geekiest guy I know Cafonso
- Mike Culver's Presentation. That was what I was there for.

The Bad :
- The Wireless bandwidth available.
- The food.
- Did I mention the low bandwidth (well, the codebits page is kind of remeniscent of a heyday of 16k modems, but come on!!)

The Ugly :
- PT's Pulso app.
I mean, the app/system in itself looks great and seems to be a wonderful piece of enterprisey software, but PT taking advantage of Open Source Software to build a great product and then selling it? What are they giving back to the community? Bug-fixes? Is that enough for such a big company? Shouldn't we expect a little more? Ok, this is just one more reason why I don't like PT, Sapo or any of the PTM companies.

Final verdict:
- If you were there, probably you had fun. If you weren't ,don't feel too bad. It's a well over hyped event.

I'll be back tomorrow, and hopefully I'll be able to catch up again with some of the folks I've met today and be able to see some more presentations.

toad codebits day 1

2007-11-13T17:25:00.000+01:00

Well, it seems that I made the cut after all, but I only managed to get here some 30 minutes ago.

Not all is lost, I still managed to catch Mike Culver talk about Amazon WebServices, namely S3 and the amazing EC2. As soon as I'm able I'll post an update about the talk itself and my first impressions.

Stay tuned.

Toad CodeBits

2007-11-03T18:22:00.000+01:00

We're just 10 days away from Toad CodeBits.

This promises to be the biggest gathering of 'tuga* code monkeys this year and I'm looking forward to being there. Although, come to think of it, I don't know if I'll actually make it. The thing is, it seems that you have to both register for the event and then make some sort of announcement and hope that you make the final cut.

That last bit seems to be a problem for me, 'cause I really don't like Sapo (the company, the search engine, the portal, the....) at all. But since I have to admit that I would really like to be there, here it goes....

If I manage to get in, I'm looking forward to hearing Mike Culver from Amazon, Marco Gonçalves (on the BSDs) and hu... wraygunn

* 'tuga is slang for Portuguese.

Abertura Facil

2007-10-24T14:48:00.000+02:00

Afinal não sou o unico a ter um problema com embalagens de "abertura facil".

Freedom (I still think this is the end of the record industry)

2007-10-09T13:20:00.000+02:00

08 october 2007: big news
hello everyone. i've waited a long time to be able to make the
following announcement: as of right now nine inch nails is a totally
free agent, free of any recording contract with any label. i have
been under recording contracts for 18 years and have watched the
business radically mutate from one thing to something inherently very
different and it gives me great pleasure to be able to finally have a
direct relationship with the audience as i see fit and appropriate.
look for some announcements in the near future regarding 2008.
exciting times, indeed.
posted by trent reznor at 10:45 am.

More information on the usual place

FASTA, betta, more

2007-10-03T11:26:00.000+02:00

My girlfriend's sister asked for help. But all she got was a 16.

The purpose of this script is to get a file(name) as a first argument, a regexp as a second argument and then search trough the file and print out the whole sequence where any of the possible regexp values are found, being that the searched sequence itself must be identified with "<>" symbols and then do a little basic math with the elements we've found.

To try this out, save the following as (for instance) sequences.txt:

>50c's and 50t's
cccccccccccccccccccccccccccccccccccccccccccccccccctttttttttt
tttttttttttttttttttttttttttttttttttttttt
>10G's and 90A's
GGGGGGGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>A random sequence
ccagtcctgtctaaggactttggttcatgcgttaatttcggttagccagtggcgcccacg
taacaaagtgcgaccgacctgcttccatagcattgaaatgtccttgattggagattttac
gcaggaggactgataagttcgggtctgaattgatgcagcgaacgttcatccaatactcag
acttgcactcagtcg
>A second random sequence
cgcatgacggccctcctcgacggttcattaaccttgcacaccaactgttcctcaaccgat
ctggtgtctttctcacttacatagcagttgctgtaccatttgatgggaacccgagatcac
cgggttatcgcgggagtttattccgaattgttctcggaaatgtggcgtcggcttgaattg
ggaataatacggatcttgacaagcacgatttcatccacaatgcggcacgagtaatcccct
tctggaaggatgcagaaaggacatatacaatgagctagccacgtggcgcataacgcagct
tggttagaaactaaatctatacaggaagatacagaatgggaacagtgtcgctcagtctag
ccagctagatccgcctttagtcgaccttaggggtaaggca

And the below code as scripty.pl:

print "\n\n *girfriends_sister_school_id* \*girfriends_sisters_friend_school_id*\n\n";
print "filename:\n";
$filename = ;
open(TEMPFILE, $filename) or die("Cannot open the file $filename");
print "Insert the regular expression to find:\n";
chomp($regexp=);
while () {

if ( /^>/xms) {
$paragraph = "";
$paragraph_head = $_
}
if ( /^$/xms) {
push @paragraphs, $paragraph;
} else {
$paragraph .= $_;
}
}
push @paragraphs, $paragraph;
foreach (@paragraphs) {
while ( $_ =~ /($regexp)/gi) {
$expressions{$1} += 1;
}
}
foreach $key (keys %expressions) {
print "\n\nPattern = $key\n";
foreach (@paragraphs) {
if ($_ =~ /$key/) {
$paragraph_with_patterns = $_;
$total = length$paragraph_with_patterns;
$counterA = 0;
$counterC = 0;
$counterT = 0;
$counterG = 0;
if ($key =~ /a/){
while ( $paragraph_with_patterns =~ /a/gi) {
$counterA += 1;
$sum1 = ($counterA/$total);
}
}
if ($key =~ /c/){
while ( $paragraph_with_patterns =~ /c/gi) {
$counterC += 1;
$sum2 = ($counterC/$total);
}
}
if ($key =~ /t/){
while ( $paragraph_with_patterns =~ /t/gi) {
$counterT += 1;
$sum3 = ($counterT/$total);
}
}
if ($key =~ /g/){
while ( $paragraph_with_patterns =~ /g/gi) {
$counterG += 1;
$sum4 = ($counterG/$total);
}
}
$paragraph_with_patterns =~ s/($key)/\<$1\>/gi;
print "$paragraph_with_patterns\n\n";
%sum = ();
%sum1 = ();
%sum2 = ();
%sum3 = ();
%sum4 = ();
if ($counterA >0){
%sum1 = ("A", $counterA);
}
if ($counterC >0){
%sum2 = ("C", $counterC);
}
if ($counterT >0){
%sum3 = ("T", $counterT);
}
if ($counterG >0){
%sum4 = ("G", $counterG);
}
%sum = (%sum1,%sum2,%sum3,%sum4);
foreach $key_id (sort hashValueDescendingNum (keys(%sum))) {
$div = ($sum{$key_id}/$total);
print "$key_id = $sum{$key_id} \/ $total = $div\n";
}
}
}
}
sub hashValueDescendingNum{
$sum{$b} <=> $sum{$a};
}
exit;

Then run perl scripty.pl . Put sequences.txt as the file and a[c|t]g as the regexp when prompted.

I had alot of fun doing this wich is a good thing since I didn't get paid.

And no, neither bio::perl, nor any other module for that matter, were options.

Finally, a major thank you must go out to sab for the priceless (as in: he didn't get paid either) help.

::1

2007-10-02T09:31:00.001+02:00

This is my new home. I won it in a City contest.

As another geek has said before, the only hard thing to do when moving to a new 127.0.0.1 (or ::1 in IPv6) is dealing with the gas company. What a bunch of pricks!

Well, anyways you're always ...

that's cool

2007-08-14T19:42:00.000+02:00

Quicky:

Are you using OS X to develop the next big Rails app and need ImageMagick, RMagick and friends?

Well, just point your browser to rubyforge and download the rmagick-osx-installer package, unzip it and read the fine manual. If you have all the pre-requisites, "sudo run" the installer script and then... go out for a coffee.

When you're back you'll have the following log in your terminal windows:

libpng was installed successfully
libjpeg was installed successfully
ghostscript was installed successfully
ghostscript-fonts-std was installed successfully
FreeType was installed successfully
libwmf was installed successfully
ImageMagick was installed successfully
RMagick was installed successfully
Removing rm_install_tmp directory...Done

That simple.

Rediscovering the desktop

2007-08-02T23:25:00.000+02:00

As you might have noticed, I've been on a rather long break from my blogging activity, and again this was due to my Mac being broken. Again.

It's not like I didn't have a replacement (my old trusty Asus M6N), but as I've said before, i get depressed when my Mac brakes. And it just happens oh so many times.

Anyway, the downside, apart from the depression bit, was that I missed the opportunity of ego-blogging about the brand new Ruby-Lang Portuguese site .I'm very proud of being a part of the amazing team behind it, and sincere kudos must go out to Emanuel and Franc.

On the upside I had the chance of rediscovering Linux on the laptop!
I'm lucky that my Asus is a pretty linux-compatible, but with the new Ubuntu 7.04, everything just works. That includes wireless, the extra (media) buttons, the compiz powered desktop effects, the works.

Now, I've been known to prefer Suse/Novel over any Debian based system for users and user-grade hardware, but Ubuntu has been making such an extraordinary evolution that it has (for all that I care) become the de facto distro for desktop use. It just gives you roughly 70% you'll need from the first boot, and the rest you'll get with Automatix. For a little more specific usage needs, the excellent Aptitude app will do the trick. You'll never get so much for so little!

Anyway, here's a little list of apps I've been (re)discovering:
Aptana + RadRails (Netbeans, eat your heart out!. Thankfully its cross-platform);
F-Spot (will give iPhone a run for its money any day);
Songbird (think iTunes minus clutter);
Gnome-Launch-Box (it's a Quicksilver clone, gets the job done);

And a list of what I miss:
Integrated Dictionary just a shortcut away;
Textmate (it was growing on me...);
Dashboard (what? I love eye candy...);

That's not so bad is it?

Making the enterprise see red - part I

2007-07-03T19:40:00.000+02:00

Ruby trough Rails has been a poster-child for the so called web 2.0, but in the enterprise level the adoption rate hasn't been all that remarkable.

Rather than go trough an extensive diatribe about how adoption rates in the enterprise for just about any open source technology is always necessarily slow, because no self respecting OSS programmer plays golf, I'll just list some of the perceived weaknesses and shortcoming usually attributed to Ruby.
- Contrary to Perl, it doesn't come installed by default on just about every Unix-like OS;
- The treathing model used is week;
- Rails doesn't scale;
- It's just a fad, and it will go away before it matures;
- Poor Unicode support;
- No single good IDE and Text Editors are soo 80's;
- Nobody wants to learn yet another language especially when there is close to 0 employability for it;

While most of these are (at least to some extent) true, there are many projects that aim at overcoming them. And Ruby itself is still just version 1.8.6 at this point.

One such project seems to be catching enough wind behind it so that it could drive Ruby into mass (wishful thinking here...) adoption. JRuby.

Now, one might expect that the "J" would stand for Japanese, but remarkably it stands for Java. Isn't that ironic? Ruby is sometimes hailed as "What programmers should be using to still have time for a personal life" contrary to Java's "Write once. Then again, Just one more time... Ok, call your mom and cancel dinner" motto.

Jruby (which just recently reached the 1.0 mark) is a pure Java implementation of Ruby, and it's developed by Thomas Enebo and Charles Nutter with Ola Bini also being credited here and there, and, to some extent, sponsored by SUN. It aims at being more that just another implementation of Ruby (not that there are many...) which means that while still programming in pure Ruby, a coder can now enjoy the following added benefits:
- Java's scaling capabilities since Ruby code now runs inside a JVM which means parallelization in multi-processor setups ;
- An optimized Database connectivity with JDBC;
- Same level of Java's Unicode support;
- Garbage Collection handled by Java. (don't we all appreciate that?);
- A great IDE (Netbeans 6. Packed with all typical goodies plus code completion and a Swing Form Builder, it just might be the VB6 of the XXI century), plus a pretty good one (XCode + a hack);
- Access to those millions of lines of code in Java classes;

And last but not least : Integration. This is the one that's going bring it home.

With Jruby and a rails plugin called GoldSpike (previously rails-integration) we're a simple rake command away from turning any Rails app into a standard WAR file, which in turn can be deployed in either Tomcat or Glassfish or presumably just about any other applet container.

What this means is, in an enterprise environment where you have all these layers (think MVC in different LAN segments) set up and where any innovation is foreseen as potentially disruptive if not outright forbidden, we can easily introduce Ruby and Rails code, and from a manager's point of view its a win-win situation where the developers get things done faster, and the implemented structure is maintained without any hiccups. And they still get Sun's level of support.

In parts II and III I'll be showing some code and examples of rapid deployment with JRuby.

The Automator

2007-06-11T13:00:00.000+02:00

I've always been one to dislike repetitive tasks. I think it's partially because I find it hard to concentrate for a long time on tedious chores and partially because I fear getting carpel tunnel syndrome.

Just this weekend my "disability" was put to the test. I found myself going trough 8 GB of assorted files (note to self: do _not_ label zipped backups "stuff"...) trying to find a couple of pictures I wanted my girlfriend to see. I didn't know the filenames (note to self: rename the pictures I like because PIC00731 or DSC00239 aren't real _names_) or the time stamps.

Know, if I was "doing" Windows, I would pull out one of my 50+ lines VBS's, but that wouldn't get me no lollypop. I might had tried a bash-slash-perl trick to move only a couple of selected filetypes onto a new folder, but that wouldn't get me too far either since I would still need at least one more action to open all of them. And my girlfriend would leave before waiting for me to get the script right....

The solution ended up being my new favorite Mac OSX app. Automator.

Automator comes bundled with OSX 10.4 and basically it's a tool that provides you with a way to visually set up a group of actions that get a specific job done. And they call it a workflow, which pretty much sums it up.

Although you would use it to build a program, the programming background needed to use is zero, and the learning curve is neglectable.

After analyzing my specific needs, I came up with this list of necessary steps:
1 - specify the main folder;
2 - get the folder contents, repeating for each of the subfolders;
3 - filter the specified finder items by file type;
4 - decide what to do with them, in this case, I wanted to open the images in Preview so i could see them and find the ones I really needed.

And this was what I got:

Not bad huh?

By selecting and dragging the specific actions from the action list on the left to the right side pane and then changing a couple of options I was done! I saved it as an Application, runned it and 2 minutes later I was seeing the images trough Preview's Slideshow feature.

tiananmen e o "massacre" de berlin. em perspectiva

2007-06-06T19:12:00.000+02:00

Fez esta semana anos que estudantes e outros bebados se juntaram numa manifestação sem precedentes na praça de Tiananmen para gritar pelo benfica e lutar pela democracia na china. Também fez anos a Angelina Jolie, mais merecedora de manifestações e apelos, mas muito menos interessante enquanto fenomeno social.

Em Rostock esta semana houve (uma vez mais) confrontos numa manifestação organizada como protesto anti-globalização, o que prova que quase vinte anos depois e a quase meio mundo de distancia, um pais moderno e democratico também consegue atiçar a policia sobre jovens manifestantes e tudo em nome da defesa daquilo em que acreditam. Se não é a ordem e disciplina chinesa, então que seja a democracia capitalista ocidental.

Este semana morreu um blogger, um fotografo, um amigo, um professor, um ser humano de fazer corar de humildade qualquer palerma que se ache com alguma piada ou que julgue perceber alguma coisa sobre alguma coisa.

Não há ninguem que tenha frequentado o IADE (ou que conheça alguém que tenha frequentado o IADE) que não tenha ouvido falar do Prof. Roberto.

A sua perda é irreparavel, mais de 600 comentários no seu ultimo post e a multidão no seu velório ontem á noite dão-me razão. Muitos mais nunca o esquecerão.

morabeza roberto!

On job offers and career management pt II - The end is the beginning is the end

2007-05-26T00:33:00.000+02:00

Well, after much consideration and hearing lots of opinions (which I respectfully considered and discarded) I've decided to stay at my current job for now.

You know, sometimes it's not just about the money for me. I would miss the friends I've made (I can't believe I keep calling my coworkers "friends") and I would miss Solaris. And AIX, and Informix and Perl and... and to be completely honest, the offer wasn't all that you know? I mean, I actually heard the words "We only sell Microsoft technologies because if we didn't they would badmouth us to our potential costumers" and _that_ is something I want to stay away from.

And yeah, the title of this post is a reference to "batman and robin", because that's how I feel sometimes when I'm working with likes of "no-time-to-blog"er, penantes, "still offline" sab and "blogui? isso não é da SUN não" alex.

...And I _do_ mean the fellowship part, not the homosexual connoted male in tights thing, ok???

+1

2007-05-24T20:03:00.000+02:00

Tuesday Penantes switched.

I'm counting the number of "converts" I've brought into the light ... does anybody know how many I'll need so I get a free toy from Steve?

Some people are just... different!

2007-05-15T19:45:00.000+02:00

"As the climate grows more and more desperate for record labels, their answer to their mostly self-inflicted wounds seems to be to screw the consumer over even more. A couple of examples that quickly come to mind:

* The ABSURD retail pricing of Year Zero in Australia. Shame on you, UMG. Year Zero is selling for $34.99 Australian dollars ($29.10 US). No wonder people steal music. Avril Lavigne's record in the same store was $21.99 ($18.21 US).
By the way, when I asked a label rep about this his response was: "It's because we know you have a real core audience that will pay whatever it costs when you put something out - you know, true fans. It's the pop stuff we have to discount to get people to buy."
So... I guess as a reward for being a "true fan" you get ripped off.

* The dreaded EURO Maxi-single. Nothing but a consumer rip-off that I've been talked into my whole career. No more.

The point is, I am trying my best to make sure the music and items NIN puts in the marketplace have value, substance and are worth you considering purchasing. I am not allowing Capital G to be repackaged into several configurations that result in you getting ripped off.

We are planning a full-length remix collection of substance that will be announced soon."

Posted by Trent Reznor, as seen on : http://www.nin.com/tr/default.aspx

FARM project (*)

2007-05-12T14:54:00.000+02:00

You might have heard me ~~drool~~ about having helped implement the first Rails app at work.

If you read this blog regularly, you might even know that this was a project done in collaboration with penantes.

Now, what has been missing is an overview of the technology used and a brief explanation thereof.

The project itself is little more that a web-based front-end to penantes's voodoo-like perl scripts and it's purpose is solely of giving interested parties a better view of the ~~spell's~~ script's results.

Well, we had an old Dell Poweredge laying around, so that was the machine used. It had an ancient implementation of Red Hat 8 (actually. I think it was vd who installed it) so that had to go. Not so much because it was old, but because it was Red Hat. And no noticeable services running around so a clean install it would be.

For OS we chose FreeBSD. We wasn't our first choice, but Ubuntu didn't correctly recognize the SCSI controllers and the openSolaris DVD was well...a DVD, and Debian 4 was late. The machine at this time didn't have a working network connection and only a CD drive for media. Since FreeBSD is a distant cousin from both Solaris and Mac (I just had to bring this up) it was the next best thing.

The install was easy enough and the software available was pretty much all we needed.
For web serving we have Apache, for database we used Mysql, and has i've said, we used Rails for development. And apart from configuring Apache with fcgid which is a hole new post subject, everything runs just fine for now.

Recommended reading Rails on FreeBSD wiki page.

(*) in case you didn't notice....
FreeBSD
Apache
Rails
Mysql

27th birthday

2007-05-12T14:19:00.000+02:00

My favorite birthday presents:

i can't do what???

2007-05-02T12:53:00.000+02:00

09F911029D74E35BD84156C5635688C0

or if you prefer...

0x09F911029D74E35BD84156C5635688C0

On job offers and career management (edited)

2007-04-29T18:46:00.000+02:00

Recently i've been reading a fellow *'s musings on job searching and expectations and focus on career management, and although I mostly agree with his opinions and objectives, I can't stop but wondering if I (or most people, for that matter) can afford to be as straightforward as he seems to be.

In my career, and up until some 6 months ago, I've been mostly involved with Microsoft products and technologies. I've developed, administrated and and maintained applications, databases, systems and networks. However, Linux and Open Source in general have been my hobby and, i dare say, passion for the last 8 years or so. Cutting a long story short, in a Windows world I'm (somewhat) highly valued, but in a Unix\Linux context, I'm bound to be considered a junior staff member for a couple of years more.

Now, if the job title doesn't really bother me, the difference in wage is staggering. Enough to make me consider a jump back.

All this is only important when I'm faced with a difficult decision like I am right now.

I've managed to get a good deal of respect and appreciation on my current job, I've been involved with some very interesting technologies and have been given the chance to use Open Source technologies and am currently in the process of finishing up my first professional (cof...cof...) Ruby on Rails application, but the wage is ridiculous.

On the other hand, I have an offer to get back to ~~a development only~~ a sysadmin only position, but using ~~.Net and other~~ mostly Microsoft technologies. The pay is good, the challenge is well, challenging and the work environment as far as I could gather so far is very good. On the downside there will be plenty of grey suits and ties in my future. And a senior colleague who thinks rails is amateurish. But the boss says I can use whatever technologies I see fit to get the job done. And they both actually read my resume. And want _me_ to work for them.

Well, as you might have guessed the wage is the only thing that's making me consider the change, and the love for open technologies the only thing thats keeping me back.

In a ideal scenario I would refuse the change hands down, but these are not ideal times, so I'll have to sleep on it and hope for the strength to make the best decision.

Well things change quickly when you let them. There was a sysadmin position available too, and although I refused the developer job, I'll most likely be accepting the later. Stay tuned....

If only we had known earlier...

2007-04-29T15:45:00.000+02:00

As seen on The freedom blog...

"Linux hackers! They aren’t smart enough to scare Bill Gates… and they certainly aren’t smart enough to scare Jesus. Did you know that He protects this website too? I prayed it, and it happened! All attacks rebuffed! All sin kept far from these pages.
Thank you Lord!"

By the way, did you know that if you use Ubuntu Christian Edition you can stop daemons with the command "Exorcize!" ? And that you can use "bless" whenever a program fails to start? Just beware not to issue a "chmod 666" , or you'll go to hell!!

Oh @wathever, forgive them, for they are funny. Seriously, I thought that sarcasm was beyond americans.

What caught my eye this week

2007-04-26T23:30:00.000+02:00

Brand of the year:

Google, witch you know already so I wont link to their site, was recognized this week as the the world's top-ranked brand.

In only 10 years, Google's Sergey and Lary managed to top decades old brands such as General Electric, Coca-Cola or even IBM.

Entering a realm occupied by only a few other companies whose brand became a synonym with their product (think Gillette) Google is an example of entrepreneurship. If you doubt it, you can always google it up. :o)

Blog of the month:

Following a tip from a new friend I've been enthusiastically reading a blog from a fellow rubyist. It's called Ruby on Windows, and as you might guess it's about using Ruby as a scripting and automation tool on MS Windows OSs. It provides some great examples and code samples witch got me thinking about replacing my vb scripts at work.

This is a great example of how to integrate an open technology with a closed system.

Year Zero. A final surprise?

2007-04-18T00:31:00.000+02:00

Year Zero, Nine Inch Nails new album was officially released today. And a few more surprises came with it.

After hearing it on repeat for about 3 hours, when i finally removed the cd from my macbook, the CD had turned from grayish into white revealing some binary code that (after some googling) "I" discovered could be translated to a link to another secret site!

And i though that it was just my macbook going _Extra_ hot this time!!

This is the beginning....